MU61907 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ATGAATTGCTAGAATCTGATGACAACTTTGGCTTCTTTGTCATGGATGGTAATGGGACACTCTTTGGCACATTGAGTAGTAACACACGTGAAGTCCTTCACAAATTTAGTGTCTACCTTCCTA
BLAST of MU61907 vs. Swiss-Prot
Match: ERF1X_ARATH (Eukaryotic peptide chain release factor subunit 1-1 OS=Arabidopsis thaliana GN=ERF1-1 PE=1 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 1.9e-13 Identity = 36/40 (90.00%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of MU61907 vs. Swiss-Prot
Match: ERF1Y_ARATH (Eukaryotic peptide chain release factor subunit 1-2 OS=Arabidopsis thaliana GN=ERF1-2 PE=1 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 4.3e-13 Identity = 35/40 (87.50%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of MU61907 vs. Swiss-Prot
Match: ERF1Z_ARATH (Eukaryotic peptide chain release factor subunit 1-3 OS=Arabidopsis thaliana GN=ERF1-3 PE=1 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 4.3e-13 Identity = 35/40 (87.50%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of MU61907 vs. Swiss-Prot
Match: ERF1_PODAS (Eukaryotic peptide chain release factor subunit 1 OS=Podospora anserina GN=SU2 PE=3 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 2.4e-11 Identity = 31/40 (77.50%), Postives = 32/40 (80.00%), Query Frame = 3
BLAST of MU61907 vs. Swiss-Prot
Match: ERF1_BLEAM (Eukaryotic peptide chain release factor subunit 1 OS=Blepharisma americanum GN=eRF1 PE=2 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 2.6e-10 Identity = 29/40 (72.50%), Postives = 31/40 (77.50%), Query Frame = 3
BLAST of MU61907 vs. TrEMBL
Match: M7YEJ3_TRIUA (Eukaryotic peptide chain release factor subunit 1-1 OS=Triticum urartu GN=TRIUR3_05303 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 2.2e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. TrEMBL
Match: D5LHJ0_BRAOB (Eukaryotic release factor 1-1 OS=Brassica oleracea var. botrytis GN=eRF1-1 PE=2 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 2.2e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. TrEMBL
Match: A0A068UB37_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00020458001 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 2.2e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. TrEMBL
Match: A0A059AFV6_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_J01695 PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 2.2e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. TrEMBL
Match: K4DCD9_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 2.2e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. TAIR10
Match: AT5G47880.1 (AT5G47880.1 eukaryotic release factor 1-1) HSP 1 Score: 75.1 bits (183), Expect = 1.1e-14 Identity = 36/40 (90.00%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of MU61907 vs. TAIR10
Match: AT1G12920.1 (AT1G12920.1 eukaryotic release factor 1-2) HSP 1 Score: 73.9 bits (180), Expect = 2.4e-14 Identity = 35/40 (87.50%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of MU61907 vs. TAIR10
Match: AT3G26618.1 (AT3G26618.1 eukaryotic release factor 1-3) HSP 1 Score: 73.9 bits (180), Expect = 2.4e-14 Identity = 35/40 (87.50%), Postives = 34/40 (85.00%), Query Frame = 3
BLAST of MU61907 vs. NCBI nr
Match: gi|1155261|gb|AAA91169.1| (eukaryotic release factor 1 homolog [Arabidopsis thaliana]) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. NCBI nr
Match: gi|629085918|gb|KCW52275.1| (hypothetical protein EUGRSUZ_J01695 [Eucalyptus grandis]) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. NCBI nr
Match: gi|460394082|ref|XP_004242634.1| (PREDICTED: eukaryotic peptide chain release factor subunit 1-3-like [Solanum lycopersicum]) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. NCBI nr
Match: gi|659119950|ref|XP_008459930.1| (PREDICTED: eukaryotic peptide chain release factor subunit 1-3-like [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
BLAST of MU61907 vs. NCBI nr
Match: gi|685323852|ref|XP_009151586.1| (PREDICTED: eukaryotic peptide chain release factor subunit 1-1 [Brassica rapa]) HSP 1 Score: 75.9 bits (185), Expect = 1.8e-11 Identity = 36/40 (90.00%), Postives = 36/40 (90.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|