MU61641 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ATCAAATTTTTGATCGTCGAGATTCGAGTTGGACACAGCGAGAGACAGAGAGAGATGCCTCAGCCGAGCAAAGAACCCTGCAAGAAGGAAGCGTGCGATATTCAAGCTTGTCTTTCCAAAAACAACTTTCTTCCTCACAAGTGCGTCAGGGTCATTCAACTATTGCAACTTTGCTGTGAGGACTGCGATTACAAATCAACACATTGTGCTTCTGTTTCTGACCTCTCAAAGCAAATAAAGCCGAAAAGCCAGAAATCTTGATTCAAGACATCTCAGGTGTAATCCAGTTTACAAGTCACCTCATTGGGTGTTGTTTTTAACTTGAGCCCACAATGCGACGTTTTGCGAAATAGGCGAAAGAAAGATATGAGACCAGAGGCCTTCGACAATGGACAGCTAATAAAGTTGCCATTTCTTTCCAAATCCATCACCTGCAATATTTTCTAACAAAATATTTTAATTCTTTATCTCTATGTCTAACCCTGATAAAAATTGACGATTAATTTT
BLAST of MU61641 vs. Swiss-Prot
Match: CMC4_MOUSE (Cx9C motif-containing protein 4 OS=Mus musculus GN=Cmc4 PE=2 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 6.7e-07 Identity = 22/38 (57.89%), Postives = 26/38 (68.42%), Query Frame = 1
BLAST of MU61641 vs. Swiss-Prot
Match: CMC4_BOVIN (Cx9C motif-containing protein 4 OS=Bos taurus GN=CMC4 PE=3 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 2.6e-06 Identity = 20/38 (52.63%), Postives = 26/38 (68.42%), Query Frame = 1
BLAST of MU61641 vs. Swiss-Prot
Match: CMC4_HUMAN (Cx9C motif-containing protein 4 OS=Homo sapiens GN=CMC4 PE=1 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 4.4e-06 Identity = 20/38 (52.63%), Postives = 26/38 (68.42%), Query Frame = 1
BLAST of MU61641 vs. TrEMBL
Match: A0A0A0LC41_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G228340 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 8.0e-23 Identity = 51/57 (89.47%), Postives = 53/57 (92.98%), Query Frame = 1
BLAST of MU61641 vs. TrEMBL
Match: A0A022QEZ0_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a017584mg PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 7.5e-21 Identity = 46/57 (80.70%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of MU61641 vs. TrEMBL
Match: S8D116_9LAMI (Uncharacterized protein (Fragment) OS=Genlisea aurea GN=M569_01308 PE=4 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 1.3e-20 Identity = 47/57 (82.46%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of MU61641 vs. TrEMBL
Match: D7TGV7_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_12s0035g00710 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 2.8e-20 Identity = 47/57 (82.46%), Postives = 50/57 (87.72%), Query Frame = 1
BLAST of MU61641 vs. TrEMBL
Match: A0A068TNJ3_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00014895001 PE=4 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 4.8e-20 Identity = 45/57 (78.95%), Postives = 52/57 (91.23%), Query Frame = 1
BLAST of MU61641 vs. TAIR10
Match: AT1G09794.1 (AT1G09794.1 Cox19 family protein (CHCH motif)) HSP 1 Score: 99.0 bits (245), Expect = 3.0e-21 Identity = 43/57 (75.44%), Postives = 47/57 (82.46%), Query Frame = 1
BLAST of MU61641 vs. NCBI nr
Match: gi|659112052|ref|XP_008456041.1| (PREDICTED: cx9C motif-containing protein 4 [Cucumis melo]) HSP 1 Score: 127.9 bits (320), Expect = 1.7e-26 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = 1
BLAST of MU61641 vs. NCBI nr
Match: gi|449457033|ref|XP_004146253.1| (PREDICTED: cx9C motif-containing protein 4 [Cucumis sativus]) HSP 1 Score: 114.8 bits (286), Expect = 1.5e-22 Identity = 51/57 (89.47%), Postives = 53/57 (92.98%), Query Frame = 1
BLAST of MU61641 vs. NCBI nr
Match: gi|747080868|ref|XP_011087700.1| (PREDICTED: cx9C motif-containing protein 4 [Sesamum indicum]) HSP 1 Score: 110.2 bits (274), Expect = 3.7e-21 Identity = 49/57 (85.96%), Postives = 52/57 (91.23%), Query Frame = 1
BLAST of MU61641 vs. NCBI nr
Match: gi|848900407|ref|XP_012850363.1| (PREDICTED: cx9C motif-containing protein 4 [Erythranthe guttata]) HSP 1 Score: 108.2 bits (269), Expect = 1.4e-20 Identity = 46/57 (80.70%), Postives = 51/57 (89.47%), Query Frame = 1
BLAST of MU61641 vs. NCBI nr
Match: gi|527208473|gb|EPS73449.1| (hypothetical protein M569_01308, partial [Genlisea aurea]) HSP 1 Score: 107.5 bits (267), Expect = 2.4e-20 Identity = 47/57 (82.46%), Postives = 51/57 (89.47%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|