MU61596 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AAGTGATGCACGTCTTCTACGTCGCAATGCTATGTGTCGAGGAACAGGCAGTGGAGCGCCCAACAATGCGGGAAGTGATCCAAATCCTATCGGAGATTCCACAGCCACCAAGTTCCAAACAAGGAGGAGATTCAACACTCCCCAACTCGTCACCACCCCCACCACCAACAGCTGCAGATTTAGACCTTCCAACAACAGGAACCAAGAACAAAAAAGAGCATCAGCAACAGCAACCGCCACCAGATCTTCTTAGCATTTGAACAACTTAGTTGGGGTTGGTAGTGTCTCTACTGTCTTTCGCAAGGTCCAAACAATTAAAGCTTTGGCTCTTGGACCTGCGATGTCGTTTATTTTTCTTTTGGGGGGATTAGGTTTGGTTTTTTTTAATGTTATGGTACTAATGTTCAAAAGTTCCTTTTTTCTTTTTTTTTCTTTTCATGTACAGTTGACCAGTTGGGTTTATTGGGGGAGGGTATTTTCCTATGAGATTGTTCTTTTCTAATGTTGAAGCATTTCCACT
BLAST of MU61596 vs. Swiss-Prot
Match: BAME2_ARATH (Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM2 OS=Arabidopsis thaliana GN=BAM2 PE=1 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 3.5e-11 Identity = 33/40 (82.50%), Postives = 35/40 (87.50%), Query Frame = 3
BLAST of MU61596 vs. Swiss-Prot
Match: BAME1_ARATH (Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 OS=Arabidopsis thaliana GN=BAM1 PE=1 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 4.6e-11 Identity = 33/39 (84.62%), Postives = 34/39 (87.18%), Query Frame = 3
BLAST of MU61596 vs. Swiss-Prot
Match: BAME3_ARATH (Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM3 OS=Arabidopsis thaliana GN=BAM3 PE=2 SV=3) HSP 1 Score: 52.8 bits (125), Expect = 4.5e-06 Identity = 22/34 (64.71%), Postives = 28/34 (82.35%), Query Frame = 3
BLAST of MU61596 vs. TrEMBL
Match: A0A0A0KJT6_CUCSA (Non-specific serine/threonine protein kinase OS=Cucumis sativus GN=Csa_6G497080 PE=3 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 6.7e-25 Identity = 63/85 (74.12%), Postives = 63/85 (74.12%), Query Frame = 3
BLAST of MU61596 vs. TrEMBL
Match: M5WS11_PRUPE (Non-specific serine/threonine protein kinase OS=Prunus persica GN=PRUPE_ppa000739mg PE=3 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 3.3e-16 Identity = 52/89 (58.43%), Postives = 57/89 (64.04%), Query Frame = 3
BLAST of MU61596 vs. TrEMBL
Match: F6HWW0_VITVI (Non-specific serine/threonine protein kinase OS=Vitis vinifera GN=VIT_00s1353g00010 PE=3 SV=1) HSP 1 Score: 92.8 bits (229), Expect = 4.3e-16 Identity = 52/88 (59.09%), Postives = 57/88 (64.77%), Query Frame = 3
BLAST of MU61596 vs. TrEMBL
Match: A0A067KAV0_JATCU (Non-specific serine/threonine protein kinase OS=Jatropha curcas GN=JCGZ_12604 PE=3 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 9.6e-16 Identity = 47/85 (55.29%), Postives = 57/85 (67.06%), Query Frame = 3
BLAST of MU61596 vs. TrEMBL
Match: V4RX11_9ROSI (Non-specific serine/threonine protein kinase OS=Citrus clementina GN=CICLE_v10024796mg PE=3 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 2.8e-15 Identity = 49/89 (55.06%), Postives = 58/89 (65.17%), Query Frame = 3
BLAST of MU61596 vs. TAIR10
Match: AT3G49670.1 (AT3G49670.1 Leucine-rich receptor-like protein kinase family protein) HSP 1 Score: 69.7 bits (169), Expect = 2.0e-12 Identity = 33/40 (82.50%), Postives = 35/40 (87.50%), Query Frame = 3
BLAST of MU61596 vs. TAIR10
Match: AT5G65700.1 (AT5G65700.1 Leucine-rich receptor-like protein kinase family protein) HSP 1 Score: 69.3 bits (168), Expect = 2.6e-12 Identity = 33/39 (84.62%), Postives = 34/39 (87.18%), Query Frame = 3
BLAST of MU61596 vs. TAIR10
Match: AT4G20270.1 (AT4G20270.1 Leucine-rich receptor-like protein kinase family protein) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-07 Identity = 22/34 (64.71%), Postives = 28/34 (82.35%), Query Frame = 3
BLAST of MU61596 vs. TAIR10
Match: AT1G75820.1 (AT1G75820.1 Leucine-rich receptor-like protein kinase family protein) HSP 1 Score: 48.1 bits (113), Expect = 6.2e-06 Identity = 20/34 (58.82%), Postives = 26/34 (76.47%), Query Frame = 3
BLAST of MU61596 vs. NCBI nr
Match: gi|449451345|ref|XP_004143422.1| (PREDICTED: leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 8.1e-24 Identity = 63/85 (74.12%), Postives = 63/85 (74.12%), Query Frame = 3
BLAST of MU61596 vs. NCBI nr
Match: gi|659081032|ref|XP_008441113.1| (PREDICTED: leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1, partial [Cucumis melo]) HSP 1 Score: 119.0 bits (297), Expect = 8.1e-24 Identity = 63/85 (74.12%), Postives = 63/85 (74.12%), Query Frame = 3
BLAST of MU61596 vs. NCBI nr
Match: gi|645219770|ref|XP_008237309.1| (PREDICTED: leucine-rich repeat receptor-like serine/threonine-protein kinase BAM1 [Prunus mume]) HSP 1 Score: 90.1 bits (222), Expect = 4.0e-15 Identity = 52/89 (58.43%), Postives = 57/89 (64.04%), Query Frame = 3
BLAST of MU61596 vs. NCBI nr
Match: gi|595842447|ref|XP_007208421.1| (hypothetical protein PRUPE_ppa000739mg [Prunus persica]) HSP 1 Score: 90.1 bits (222), Expect = 4.0e-15 Identity = 52/89 (58.43%), Postives = 57/89 (64.04%), Query Frame = 3
BLAST of MU61596 vs. NCBI nr
Match: gi|296088218|emb|CBI35733.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 89.7 bits (221), Expect = 5.2e-15 Identity = 52/88 (59.09%), Postives = 57/88 (64.77%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|