MU61222 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CAAAATTCTCTTTCAATATCAACTCTCCTCTCTTAACTCACCCTTTTTTCAAATGGAAACAATGCAAACCATCGACTTCTCTTTTCACGTACGAAAATGCCAACCAGAATTGATTGCACCAGCAAATCCTACACCCTATGAATTTAAACAACTTTCTGATGTGGATGATCAACAAAGCTTAAGGCTTCAATTGCCATTCGTAAATATCTATCCCCATAATCCAAGTTTGGAGGGAAGAGATCCAGTGAAGGTAAAGAATCGATAATTACATGAAATGCCATATCACGGTCAATATTTCACGATGAAATGACCAAAATATATACTTCACATATTGTATTTGTACCGTCAGGTCTTCTCATATTTCTAATGTGTGGTTCAT
BLAST of MU61222 vs. Swiss-Prot
Match: ACMAT_VITLA (Methanol O-anthraniloyltransferase OS=Vitis labrusca GN=AMAT PE=1 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 9.5e-14 Identity = 32/57 (56.14%), Postives = 41/57 (71.93%), Query Frame = 2
BLAST of MU61222 vs. Swiss-Prot
Match: HLTT_LUPAL (13-hydroxylupanine O-tigloyltransferase OS=Lupinus albus GN=HMT/HLT PE=1 SV=1) HSP 1 Score: 75.9 bits (185), Expect = 3.6e-13 Identity = 36/63 (57.14%), Postives = 42/63 (66.67%), Query Frame = 2
BLAST of MU61222 vs. Swiss-Prot
Match: BEBT_TOBAC (Benzyl alcohol O-benzoyltransferase OS=Nicotiana tabacum GN=HSR201 PE=1 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 2.3e-12 Identity = 34/67 (50.75%), Postives = 45/67 (67.16%), Query Frame = 2
BLAST of MU61222 vs. Swiss-Prot
Match: BEBT_CLABR (Benzyl alcohol O-benzoyltransferase OS=Clarkia breweri PE=1 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-11 Identity = 33/59 (55.93%), Postives = 42/59 (71.19%), Query Frame = 2
BLAST of MU61222 vs. Swiss-Prot
Match: CHAT_ARATH ((Z)-3-hexen-1-ol acetyltransferase OS=Arabidopsis thaliana GN=CHAT PE=1 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 1.2e-08 Identity = 32/62 (51.61%), Postives = 37/62 (59.68%), Query Frame = 2
BLAST of MU61222 vs. TrEMBL
Match: Q84S99_CUCME (Alcohol acyltransferase OS=Cucumis melo GN=GeAAT-2 PE=2 SV=1) HSP 1 Score: 142.5 bits (358), Expect = 3.5e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 2
BLAST of MU61222 vs. TrEMBL
Match: Q8W3L7_CUCME (Alcohol acetyltransferase OS=Cucumis melo GN=GeAAT-1 PE=2 SV=1) HSP 1 Score: 142.5 bits (358), Expect = 3.5e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 2
BLAST of MU61222 vs. TrEMBL
Match: B1A9J8_CUCME (Alcohol acetyltransferase OS=Cucumis melo GN=AAT PE=2 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 4.7e-28 Identity = 63/67 (94.03%), Postives = 63/67 (94.03%), Query Frame = 2
BLAST of MU61222 vs. TrEMBL
Match: Q8SA67_CUCME (Putative acyltransferase OS=Cucumis melo GN=AT2 PE=2 SV=1) HSP 1 Score: 132.1 bits (331), Expect = 4.7e-28 Identity = 63/67 (94.03%), Postives = 63/67 (94.03%), Query Frame = 2
BLAST of MU61222 vs. TrEMBL
Match: P93094_CUCME (Putative uncharacterized protein (Fragment) OS=Cucumis melo PE=2 SV=1) HSP 1 Score: 129.4 bits (324), Expect = 3.1e-27 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = 2
BLAST of MU61222 vs. TAIR10
Match: AT5G17540.1 (AT5G17540.1 HXXXD-type acyl-transferase family protein) HSP 1 Score: 64.3 bits (155), Expect = 6.1e-11 Identity = 31/65 (47.69%), Postives = 40/65 (61.54%), Query Frame = 2
BLAST of MU61222 vs. TAIR10
Match: AT3G03480.1 (AT3G03480.1 acetyl CoA:(Z)-3-hexen-1-ol acetyltransferase) HSP 1 Score: 60.8 bits (146), Expect = 6.7e-10 Identity = 32/62 (51.61%), Postives = 37/62 (59.68%), Query Frame = 2
BLAST of MU61222 vs. NCBI nr
Match: gi|28804752|dbj|BAC58010.1| (alcohol acyltransferase [Cucumis melo]) HSP 1 Score: 144.4 bits (363), Expect = 1.3e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 2
BLAST of MU61222 vs. NCBI nr
Match: gi|17351914|dbj|BAB78588.1| (alcohol acetyltransferase [Cucumis melo]) HSP 1 Score: 144.4 bits (363), Expect = 1.3e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 2
BLAST of MU61222 vs. NCBI nr
Match: gi|659125710|ref|XP_008462821.1| (PREDICTED: benzyl alcohol O-benzoyltransferase-like [Cucumis melo]) HSP 1 Score: 144.4 bits (363), Expect = 1.3e-31 Identity = 67/67 (100.00%), Postives = 67/67 (100.00%), Query Frame = 2
BLAST of MU61222 vs. NCBI nr
Match: gi|18652312|gb|AAL77060.1|AF468022_1 (putative acyltransferase [Cucumis melo]) HSP 1 Score: 134.0 bits (336), Expect = 1.8e-28 Identity = 63/67 (94.03%), Postives = 63/67 (94.03%), Query Frame = 2
BLAST of MU61222 vs. NCBI nr
Match: gi|661902804|ref|NP_001284403.1| (benzyl alcohol O-benzoyltransferase-like [Cucumis melo]) HSP 1 Score: 134.0 bits (336), Expect = 1.8e-28 Identity = 63/67 (94.03%), Postives = 63/67 (94.03%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|