MU60698 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CATAATACACAAACCAGCTTATTCATTCTAACCAGCTCACTACTTAACTGCCAAATATCTCTCTGTTTTTAGTGATCCATCTTGTGAAGTAGTTTATTTCATACCCATGGCGGATTGCGAGAACAAGAAGGTCGAGGAGGGAGTTCAAGAGGGTGGTGTCGAGGCCACAGATCGTGGGCTGTTTGATTTCTTGGGGAAGAAGAAAGAGGAAGAGCAGGCCGAGAAGCCCCCTGTTTCTGAGGAAGAGGTGGTTGTAGTTACTGAGCAGTTCGAGAAAGTTGAAGTTTCTGAACCTTCACCGCCGGTTCATAAGGTTGAAGTAGAAGAAGAAGAAGAAGAGAAGAAGCCTAGTCTCTTGGAGAAACTCACCCGATCCGATAGCAGCTCTAGCTCATCACGATGAAGATCAAGGAAAAGAAAAGAAGGGATTTTTGGAGAAAATAAAGGAGAAACTCCCAGGGTATCACGCTAAGGAGGATCAAGAGAAGCATAAGGAGGAGGCAGCTTCTCATTGAAGATGATGATGATATGATATCATACTCCATAATGGTTTAGATCAAGATCATAAATCATCATCATCATTGTGGCCTGGAGTTCTTGATTATTAATAATGCTGTTTTTTATTTAATTATGTGTTTCTGTAAGAATTATATATGTGCTTTTTTGATGTGCATATATATATATATGGGATTTGCTTTTAAGGTGGGGAAGGGTTGTGTTTTCTTTTTCGATGTCTTTTCATTATA
BLAST of MU60698 vs. TrEMBL
Match: A0A0A0KDH7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G358710 PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 2.0e-14 Identity = 43/54 (79.63%), Postives = 45/54 (83.33%), Query Frame = 3
BLAST of MU60698 vs. TrEMBL
Match: A0A0A0KDH7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G358710 PE=3 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 1.8e-02 Identity = 32/80 (40.00%), Postives = 33/80 (41.25%), Query Frame = 3
HSP 2 Score: 33.9 bits (76), Expect = 3.4e+02 Identity = 18/37 (48.65%), Postives = 24/37 (64.86%), Query Frame = 3
HSP 3 Score: 68.2 bits (165), Expect = 1.6e-08 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = 3
BLAST of MU60698 vs. TrEMBL
Match: Q6XLQ1_CAPAN (Dehydrin-like protein OS=Capsicum annuum GN=Dhn PE=2 SV=1) HSP 1 Score: 35.4 bits (80), Expect = 1.2e+02 Identity = 15/27 (55.56%), Postives = 22/27 (81.48%), Query Frame = 3
HSP 2 Score: 29.6 bits (65), Expect = 6.5e+03 Identity = 11/24 (45.83%), Postives = 19/24 (79.17%), Query Frame = 3
HSP 3 Score: 66.6 bits (161), Expect = 4.8e-08 Identity = 34/50 (68.00%), Postives = 40/50 (80.00%), Query Frame = 3
BLAST of MU60698 vs. TrEMBL
Match: S4T684_CAPAN (Dehydrin-like protein OS=Capsicum annuum PE=2 SV=1) HSP 1 Score: 35.4 bits (80), Expect = 1.2e+02 Identity = 15/27 (55.56%), Postives = 22/27 (81.48%), Query Frame = 3
HSP 2 Score: 29.6 bits (65), Expect = 6.5e+03 Identity = 11/24 (45.83%), Postives = 19/24 (79.17%), Query Frame = 3
HSP 3 Score: 63.5 bits (153), Expect = 4.0e-07 Identity = 31/53 (58.49%), Postives = 39/53 (73.58%), Query Frame = 3
BLAST of MU60698 vs. TrEMBL
Match: C6TAX7_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_04G009400 PE=2 SV=1) HSP 1 Score: 36.2 bits (82), Expect = 6.9e+01 Identity = 16/35 (45.71%), Postives = 23/35 (65.71%), Query Frame = 3
HSP 2 Score: 30.4 bits (67), Expect = 3.8e+03 Identity = 16/32 (50.00%), Postives = 19/32 (59.38%), Query Frame = 3
HSP 3 Score: 63.5 bits (153), Expect = 4.0e-07 Identity = 31/53 (58.49%), Postives = 39/53 (73.58%), Query Frame = 3
BLAST of MU60698 vs. TAIR10
Match: AT1G20450.1 (AT1G20450.1 Dehydrin family protein) HSP 1 Score: 49.7 bits (117), Expect = 3.1e-06 Identity = 24/45 (53.33%), Postives = 28/45 (62.22%), Query Frame = 3
HSP 2 Score: 37.7 bits (86), Expect = 1.2e-02 Identity = 18/40 (45.00%), Postives = 24/40 (60.00%), Query Frame = 3
BLAST of MU60698 vs. TAIR10
Match: AT1G20440.1 (AT1G20440.1 cold-regulated 47) HSP 1 Score: 48.1 bits (113), Expect = 8.9e-06 Identity = 23/45 (51.11%), Postives = 27/45 (60.00%), Query Frame = 3
HSP 2 Score: 38.9 bits (89), Expect = 5.4e-03 Identity = 18/40 (45.00%), Postives = 28/40 (70.00%), Query Frame = 3
HSP 3 Score: 35.4 bits (80), Expect = 6.0e-02 Identity = 14/24 (58.33%), Postives = 18/24 (75.00%), Query Frame = 3
BLAST of MU60698 vs. NCBI nr
Match: gi|659129859|ref|XP_008464882.1| (PREDICTED: phosphoprotein ECPP44-like [Cucumis melo]) HSP 1 Score: 87.8 bits (216), Expect = 2.9e-14 Identity = 44/54 (81.48%), Postives = 45/54 (83.33%), Query Frame = 3
BLAST of MU60698 vs. NCBI nr
Match: gi|778715161|ref|XP_011657353.1| (PREDICTED: phosphoprotein ECPP44 [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 8.4e-14 Identity = 43/54 (79.63%), Postives = 45/54 (83.33%), Query Frame = 3
BLAST of MU60698 vs. NCBI nr
Match: gi|37905913|gb|AAO38853.1| (dehydrin-like protein [Capsicum annuum]) HSP 1 Score: 66.6 bits (161), Expect = 6.9e-08 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = 3
BLAST of MU60698 vs. NCBI nr
Match: gi|408368194|gb|AFU61110.1| (dehydrin-like protein [Capsicum annuum]) HSP 1 Score: 65.1 bits (157), Expect = 2.0e-07 Identity = 34/50 (68.00%), Postives = 40/50 (80.00%), Query Frame = 3
BLAST of MU60698 vs. NCBI nr
Match: gi|698498312|ref|XP_009795068.1| (PREDICTED: phosphoprotein ECPP44-like [Nicotiana sylvestris]) HSP 1 Score: 62.8 bits (151), Expect = 9.9e-07 Identity = 33/50 (66.00%), Postives = 39/50 (78.00%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|