MU60454 (transcribed_cluster) Melon (DHL92) v3.5.1 | Cucurbit Genomics Database (CuGenDB)

The following sequences are available for this feature:

TCATCATATTCAAACCACAATCAAGCCATATGGAAGTGAATTTCAATATCATCACCTTCTTCACCGGCGGTCTCTGGCTCTTCTTCCTCTCCTTCTTCATTCTCTTCCTCAAAACCC


Library category	ESTs
Melon mature fruit library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
MELO3C006172	MELO3C006172	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
FR10L23	FR10L23	EST