MU59874 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GGCCCATACCGATTCAACCTTCACGAGATTGACCAGCGCCGACTCCATCAAAACCTGAGAACTTCCACTACGACGACCCAACTTCTGAAGAGAGAAGGGCAACGGCTTCGCCTTCCATAGCTCCAAGCCGGTACGAAAGGCTTTCCGCCGCACCCGCCACTATGGCGAATCACCGCCCCTACTGCCACAATATTTGAATCCGTCCGGCACTGGGCATTTGTAGGTTTTCTTATCTTTCAACCGTAATTTGTTTCCTAT
BLAST of MU59874 vs. TrEMBL
Match: A0A0A0LR95_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G431110 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.0e-13 Identity = 42/48 (87.50%), Postives = 42/48 (87.50%), Query Frame = 1
BLAST of MU59874 vs. TrEMBL
Match: A0A0A0LR95_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G431110 PE=4 SV=1) HSP 1 Score: 44.3 bits (103), Expect = 8.7e-02 Identity = 20/27 (74.07%), Postives = 21/27 (77.78%), Query Frame = 2
BLAST of MU59874 vs. NCBI nr
Match: gi|700208223|gb|KGN63342.1| (hypothetical protein Csa_2G431110 [Cucumis sativus]) HSP 1 Score: 83.6 bits (205), Expect = 1.9e-13 Identity = 42/48 (87.50%), Postives = 42/48 (87.50%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|