MU58406 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GCTCCAACCCCATCTCAACCAGGCCCACCCGAGCACGACAAGATCATTCTTCAATTTGGGAAGGTTGGTAAAGACATGTTCACGATGGATTATCGATATCCGTTGTCTGCTTTTCAGGCCTTTGCTATATGCTTGAGCAGCTTTGATACCAAATTGGCTTGTGAATAAAGAAAAGTATCCAAAGTAATGCATATGATGAGCAGAAAAAAAGTAACAAAACCCCCACTTTTATGGCCCCTTTTTCTTTTCTTTTTTATTTTCAACCCTCTTTTTAACTTTTGGATTTCACTCTATTAGTTGTATTCCTCTTGTCATTTCATGGCTAGGTTAGTGAAATAGTTCATTGTTGTGGCTATTGATGTAAAAGTTAATTGTAACTGTGACATCTTCAACCCCCTCATAACAGCTCTTACATGTGCAACTTC
BLAST of MU58406 vs. Swiss-Prot
Match: TLP8_ORYSJ (Tubby-like F-box protein 8 OS=Oryza sativa subsp. japonica GN=TULP8 PE=2 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 8.6e-24 Identity = 52/55 (94.55%), Postives = 50/55 (90.91%), Query Frame = 1
BLAST of MU58406 vs. Swiss-Prot
Match: TLP14_ORYSJ (Tubby-like F-box protein 14 OS=Oryza sativa subsp. japonica GN=TULP14 PE=2 SV=1) HSP 1 Score: 107.5 bits (267), Expect = 1.2e-22 Identity = 51/58 (87.93%), Postives = 51/58 (87.93%), Query Frame = 1
BLAST of MU58406 vs. Swiss-Prot
Match: TLP3_ORYSJ (Tubby-like F-box protein 3 OS=Oryza sativa subsp. japonica GN=TULP3 PE=2 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 4.7e-22 Identity = 48/55 (87.27%), Postives = 50/55 (90.91%), Query Frame = 1
BLAST of MU58406 vs. Swiss-Prot
Match: TLP13_ORYSJ (Tubby-like F-box protein 13 OS=Oryza sativa subsp. japonica GN=TULP13 PE=2 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 5.2e-21 Identity = 50/58 (86.21%), Postives = 49/58 (84.48%), Query Frame = 1
BLAST of MU58406 vs. Swiss-Prot
Match: TLP10_ARATH (Tubby-like F-box protein 10 OS=Arabidopsis thaliana GN=TULP10 PE=1 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 2.0e-20 Identity = 49/55 (89.09%), Postives = 48/55 (87.27%), Query Frame = 1
BLAST of MU58406 vs. TrEMBL
Match: A0A0A0L6H9_CUCSA (Tubby-like F-box protein OS=Cucumis sativus GN=Csa_3G209470 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 4.6e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of MU58406 vs. TrEMBL
Match: I1KUH5_SOYBN (Tubby-like F-box protein OS=Glycine max GN=GLYMA_08G183100 PE=3 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 2.3e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
BLAST of MU58406 vs. TrEMBL
Match: A0A151T7U7_CAJCA (Tubby-like F-box protein OS=Cajanus cajan GN=KK1_017695 PE=3 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 2.3e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
BLAST of MU58406 vs. TrEMBL
Match: A0A0S3S1W7_PHAAN (Tubby-like F-box protein OS=Vigna angularis var. angularis GN=Vigan.05G012900 PE=3 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 2.3e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
BLAST of MU58406 vs. TrEMBL
Match: V4T287_9ROSI (Tubby-like F-box protein OS=Citrus clementina GN=CICLE_v10001261mg PE=3 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 2.3e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
BLAST of MU58406 vs. TAIR10
Match: AT1G25280.1 (AT1G25280.1 tubby like protein 10) HSP 1 Score: 100.1 bits (248), Expect = 1.1e-21 Identity = 49/55 (89.09%), Postives = 48/55 (87.27%), Query Frame = 1
BLAST of MU58406 vs. TAIR10
Match: AT1G43640.1 (AT1G43640.1 tubby like protein 5) HSP 1 Score: 93.6 bits (231), Expect = 1.1e-19 Identity = 44/53 (83.02%), Postives = 44/53 (83.02%), Query Frame = 1
BLAST of MU58406 vs. TAIR10
Match: AT2G47900.3 (AT2G47900.3 tubby like protein 3) HSP 1 Score: 90.9 bits (224), Expect = 6.8e-19 Identity = 39/49 (79.59%), Postives = 43/49 (87.76%), Query Frame = 1
BLAST of MU58406 vs. TAIR10
Match: AT1G76900.1 (AT1G76900.1 tubby like protein 1) HSP 1 Score: 90.9 bits (224), Expect = 6.8e-19 Identity = 45/54 (83.33%), Postives = 45/54 (83.33%), Query Frame = 1
BLAST of MU58406 vs. TAIR10
Match: AT2G18280.1 (AT2G18280.1 tubby like protein 2) HSP 1 Score: 90.1 bits (222), Expect = 1.2e-18 Identity = 39/47 (82.98%), Postives = 43/47 (91.49%), Query Frame = 1
BLAST of MU58406 vs. NCBI nr
Match: gi|778680121|ref|XP_004140690.2| (PREDICTED: tubby-like F-box protein 8 [Cucumis sativus]) HSP 1 Score: 119.4 bits (298), Expect = 5.1e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of MU58406 vs. NCBI nr
Match: gi|659112194|ref|XP_008456108.1| (PREDICTED: tubby-like F-box protein 8 [Cucumis melo]) HSP 1 Score: 119.4 bits (298), Expect = 5.1e-24 Identity = 55/55 (100.00%), Postives = 55/55 (100.00%), Query Frame = 1
BLAST of MU58406 vs. NCBI nr
Match: gi|951045096|ref|XP_014518830.1| (PREDICTED: tubby-like F-box protein 8 [Vigna radiata var. radiata]) HSP 1 Score: 117.1 bits (292), Expect = 2.5e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
BLAST of MU58406 vs. NCBI nr
Match: gi|641831569|gb|KDO50624.1| (hypothetical protein CISIN_1g014405mg [Citrus sinensis]) HSP 1 Score: 117.1 bits (292), Expect = 2.5e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
BLAST of MU58406 vs. NCBI nr
Match: gi|920712777|gb|KOM54026.1| (hypothetical protein LR48_Vigan09g268500 [Vigna angularis]) HSP 1 Score: 117.1 bits (292), Expect = 2.5e-23 Identity = 54/55 (98.18%), Postives = 54/55 (98.18%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|