MU57779 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ACTCTTCCTCTTCACCATTTCATTTCCCACAAACTAATCCCCAAAGATCAAACTCAATGACCTCTTACCGAAGCATAACCACCGCAAATTCCATCCTCGATTCTCTTTCCCTCAATCCTCCCCCCTACCCCGTCCTCCTCCTCCTCGCCGTCGTCTCCCTTTTCGTCGGCGCTTCCTGGTGGCTCTCCTACAAGTCCGCCGTTGAAGCTGCCGAGGATCACATCAACTGGATTCTCTTCGCCACACCTGTTCTCCTCAACCTTCTCGTCCGATTCCTCTCCTCTCTCGATCCCCGCTTCTTTTCTTCCTCGCCTTGGGACCGTCGCCGCCGCACGCATAATATCCCCGCCGAAGGAACCTCCCCCTGGGGCGT
BLAST of MU57779 vs. TrEMBL
Match: A0A0A0K4L6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G009710 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 7.6e-31 Identity = 72/120 (60.00%), Postives = 76/120 (63.33%), Query Frame = 3
BLAST of MU57779 vs. TrEMBL
Match: A0A0B2RN13_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_013695 PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 2.3e-11 Identity = 34/68 (50.00%), Postives = 44/68 (64.71%), Query Frame = 3
BLAST of MU57779 vs. TrEMBL
Match: I1JSF8_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_04G005500 PE=4 SV=2) HSP 1 Score: 76.6 bits (187), Expect = 2.3e-11 Identity = 34/68 (50.00%), Postives = 44/68 (64.71%), Query Frame = 3
BLAST of MU57779 vs. TrEMBL
Match: A0A0L9UH87_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan04g246300 PE=4 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 3.0e-11 Identity = 34/68 (50.00%), Postives = 42/68 (61.76%), Query Frame = 3
BLAST of MU57779 vs. TrEMBL
Match: V7AQD7_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_009G000200g PE=4 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 8.7e-11 Identity = 33/68 (48.53%), Postives = 43/68 (63.24%), Query Frame = 3
BLAST of MU57779 vs. NCBI nr
Match: gi|659094302|ref|XP_008447987.1| (PREDICTED: uncharacterized protein LOC103490309 [Cucumis melo]) HSP 1 Score: 152.9 bits (385), Expect = 3.6e-34 Identity = 78/123 (63.41%), Postives = 82/123 (66.67%), Query Frame = 3
BLAST of MU57779 vs. NCBI nr
Match: gi|700187994|gb|KGN43227.1| (hypothetical protein Csa_7G009710 [Cucumis sativus]) HSP 1 Score: 139.4 bits (350), Expect = 4.1e-30 Identity = 72/120 (60.00%), Postives = 76/120 (63.33%), Query Frame = 3
BLAST of MU57779 vs. NCBI nr
Match: gi|694439489|ref|XP_009346628.1| (PREDICTED: uncharacterized protein LOC103938347 [Pyrus x bretschneideri]) HSP 1 Score: 78.6 bits (192), Expect = 8.7e-12 Identity = 36/66 (54.55%), Postives = 43/66 (65.15%), Query Frame = 3
BLAST of MU57779 vs. NCBI nr
Match: gi|658021862|ref|XP_008346336.1| (PREDICTED: uncharacterized protein LOC103409307 [Malus domestica]) HSP 1 Score: 77.4 bits (189), Expect = 1.9e-11 Identity = 35/66 (53.03%), Postives = 43/66 (65.15%), Query Frame = 3
BLAST of MU57779 vs. NCBI nr
Match: gi|470106991|ref|XP_004289835.1| (PREDICTED: uncharacterized protein LOC101302021 [Fragaria vesca subsp. vesca]) HSP 1 Score: 77.4 bits (189), Expect = 1.9e-11 Identity = 34/66 (51.52%), Postives = 43/66 (65.15%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|