MU56774 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AGCGTCGGTGAAATTGGGGAGGCTTTCAGTTGGATCGGTGAAATTGGCTAAGAGTGGGATTGACGATCTGCTTTCGTCGACTGAGGGAGGAAAACACGATTATGATTGGCTTCTCACCCCACCTGGTACTCCTCTTTTCCCTTCATCCTCTGAAAGTGAAGTTCAATCTACGGTAGCAGCACCGAGAAGCAGCACTTTGGTCAGGTCATCTTCGACAACAAAAGCTTCGAGGCTTTCAGTTTCACAATCAGAGTGCAACAATCCTTCAAGGCCAGTGAGGAGCAGTTCCGTGTCTCGGTCCTCTGTCTCCACTCCACAGTATAGTAGTTATTCCTCCAATAGGTCCGCTTCATCAATTCTTAACACAAGCTCAGCTTCGGTTTCCTCTTACATTAGGCCTTCCTCCCCAAGTACACGCAGTGCATCCTCTGCAAGACCTTCTACTCCATCTTCACGTTCAACACCATCGAGGTCCTCAACTCCTTCAAGAGCCCGTCCATCCCCCAACAGCCCCTCCATTGAAAAACCAAGGCCACTACAAAGTTCAAGGCCATCTACTCCTAACTCTAGGCCTCAAATTCCTGCAAATTTGAGTTCTCCTGCAGCTCGGTCAAATTCCCGTCCATCTACACCTACTCGACGAAATTCTGCTCCTTCCCTCTCTTCTGTTGGCACTCCATCTTCTACGTCACGTGTTCTCTCAACAAACGGACGCAGTTCAACATCAACATCCCGACCAAGCTCCCCTAGTCCTCGGGTCCGAGCTGCACCTCAGCCAATTGTCCCCCCTGATTTTCCTCTTGATACCCCTCCAAACCTCCGAACAACATTGCCTGACCCGGCCATTTCTGCTGGTAGATCCCGTCCCACTCCTTCTGCATCGGTTAGGG
BLAST of MU56774 vs. TrEMBL
Match: A0A0A0KY97_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G335230 PE=4 SV=1) HSP 1 Score: 143.7 bits (361), Expect = 3.7e-31 Identity = 74/88 (84.09%), Postives = 75/88 (85.23%), Query Frame = 2
BLAST of MU56774 vs. TrEMBL
Match: A0A0A0KY97_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G335230 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 5.0e-20 Identity = 64/125 (51.20%), Postives = 66/125 (52.80%), Query Frame = 2
HSP 2 Score: 117.9 bits (294), Expect = 2.2e-23 Identity = 61/86 (70.93%), Postives = 64/86 (74.42%), Query Frame = 2
BLAST of MU56774 vs. TrEMBL
Match: A0A067FA23_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g008000mg PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 7.5e-08 Identity = 29/39 (74.36%), Postives = 34/39 (87.18%), Query Frame = 2
HSP 2 Score: 32.7 bits (73), Expect = 9.1e+02 Identity = 14/21 (66.67%), Postives = 18/21 (85.71%), Query Frame = 2
HSP 3 Score: 117.9 bits (294), Expect = 2.2e-23 Identity = 61/86 (70.93%), Postives = 64/86 (74.42%), Query Frame = 2
BLAST of MU56774 vs. TrEMBL
Match: A0A067FL78_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g008000mg PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 7.5e-08 Identity = 29/39 (74.36%), Postives = 34/39 (87.18%), Query Frame = 2
HSP 2 Score: 32.7 bits (73), Expect = 9.1e+02 Identity = 14/21 (66.67%), Postives = 18/21 (85.71%), Query Frame = 2
HSP 3 Score: 117.9 bits (294), Expect = 2.2e-23 Identity = 61/83 (73.49%), Postives = 63/83 (75.90%), Query Frame = 2
BLAST of MU56774 vs. TrEMBL
Match: A0A067JDE4_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_00634 PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 4.2e-11 Identity = 48/117 (41.03%), Postives = 54/117 (46.15%), Query Frame = 2
HSP 2 Score: 116.3 bits (290), Expect = 6.3e-23 Identity = 60/87 (68.97%), Postives = 68/87 (78.16%), Query Frame = 2
BLAST of MU56774 vs. TAIR10
Match: AT3G08670.1 (AT3G08670.1 unknown protein) HSP 1 Score: 88.2 bits (217), Expect = 9.3e-18 Identity = 51/83 (61.45%), Postives = 55/83 (66.27%), Query Frame = 2
HSP 2 Score: 60.1 bits (144), Expect = 2.7e-09 Identity = 31/44 (70.45%), Postives = 32/44 (72.73%), Query Frame = 2
HSP 3 Score: 33.1 bits (74), Expect = 3.5e-01 Identity = 14/21 (66.67%), Postives = 15/21 (71.43%), Query Frame = 2
BLAST of MU56774 vs. TAIR10
Match: AT2G40070.1 (AT2G40070.1 BEST Arabidopsis thaliana protein match is: proline-rich family protein (TAIR:AT3G09000.1)) HSP 1 Score: 52.8 bits (125), Expect = 4.3e-07 Identity = 25/41 (60.98%), Postives = 29/41 (70.73%), Query Frame = 2
HSP 2 Score: 43.9 bits (102), Expect = 2.0e-04 Identity = 23/43 (53.49%), Postives = 27/43 (62.79%), Query Frame = 2
BLAST of MU56774 vs. NCBI nr
Match: gi|659126630|ref|XP_008463284.1| (PREDICTED: uncharacterized protein DDB_G0271670 [Cucumis melo]) HSP 1 Score: 147.5 bits (371), Expect = 3.7e-32 Identity = 76/88 (86.36%), Postives = 76/88 (86.36%), Query Frame = 2
BLAST of MU56774 vs. NCBI nr
Match: gi|778694033|ref|XP_011653729.1| (PREDICTED: mucin-5AC [Cucumis sativus]) HSP 1 Score: 143.3 bits (360), Expect = 6.9e-31 Identity = 74/88 (84.09%), Postives = 75/88 (85.23%), Query Frame = 2
BLAST of MU56774 vs. NCBI nr
Match: gi|568855280|ref|XP_006481235.1| (PREDICTED: platelet binding protein GspB [Citrus sinensis]) HSP 1 Score: 120.2 bits (300), Expect = 6.2e-24 Identity = 62/86 (72.09%), Postives = 65/86 (75.58%), Query Frame = 2
BLAST of MU56774 vs. NCBI nr
Match: gi|802777949|ref|XP_012091017.1| (PREDICTED: putative GPI-anchored protein PB15E9.01c [Jatropha curcas]) HSP 1 Score: 117.9 bits (294), Expect = 3.1e-23 Identity = 61/83 (73.49%), Postives = 63/83 (75.90%), Query Frame = 2
BLAST of MU56774 vs. NCBI nr
Match: gi|641845279|gb|KDO64167.1| (hypothetical protein CISIN_1g008000mg [Citrus sinensis]) HSP 1 Score: 117.9 bits (294), Expect = 3.1e-23 Identity = 61/86 (70.93%), Postives = 64/86 (74.42%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|