MU54939 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GAAGCTATTCGTGTGACTGAAGCTTTTGTTTTAGGGACGGTAAATGATACGTATAATTCTATCCCTGATTTTATGAGAACTCTATTATTTAGGGATAATGGTCCTCGAGCTCTTGGTATGAGCAATGAAGAGAAAGAAAGTATGGTAGAGCTTCGAGATCAGGTACTGAGGATATGGAGACTACTTCAGTCTTCTGAAAATTTTGATCCTACACTTTTGCAACCCATTGTGCAGGTACGAATTAGCATGTTTTTCTTTTTGTGCTTTACTGAAGCTGCTACCTGTTGATACACAAATTTGAAACCACTATGTCCGAAGGAGACTTTGTTATTATTATAATTAAATGTGGCTCGCATTTCGTTGCTGATGAGAATCTCATGTGAGATGAAGTTCAATTTAAACCATATATAACTTGCCTAAATTTGTTAAATATCTTCTACAAACAGGTCCTACAACAGCCTGAGGCTCGCAGTTTTGGTGGGCGCATTTTCAGTGGGATTACTCAGCGTCTTGCAGCTCGGATGCTTCAACAAGTACTTCGAGCTTCAACGACAGTGTCTGCTTCGACTGTATAACCATTGTTGATTTGTGTACCTTTGTTAATTTCTTCGACATTCAATAATATCACTGCTGGTATATTCGTCATTGTTGCATCAATAGTGATACT
BLAST of MU54939 vs. Swiss-Prot
Match: Y1796_ARATH (Uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic OS=Arabidopsis thaliana GN=At1g79600 PE=2 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 1.7e-21 Identity = 51/79 (64.56%), Postives = 61/79 (77.22%), Query Frame = 1
HSP 2 Score: 56.2 bits (134), Expect = 5.2e-07 Identity = 28/40 (70.00%), Postives = 30/40 (75.00%), Query Frame = 3
BLAST of MU54939 vs. TrEMBL
Match: A0A0A0LYV6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G560790 PE=4 SV=1) HSP 1 Score: 155.2 bits (391), Expect = 9.1e-35 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 1
BLAST of MU54939 vs. TrEMBL
Match: A0A0A0LYV6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G560790 PE=4 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 2.2e-12 Identity = 42/42 (100.00%), Postives = 42/42 (100.00%), Query Frame = 3
HSP 2 Score: 112.8 bits (281), Expect = 5.2e-22 Identity = 59/79 (74.68%), Postives = 63/79 (79.75%), Query Frame = 1
BLAST of MU54939 vs. TrEMBL
Match: A0A097PQK7_PLAAC (ABC1-like kinase (Fragment) OS=Platanus acerifolia PE=2 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 5.8e-05 Identity = 26/34 (76.47%), Postives = 31/34 (91.18%), Query Frame = 3
HSP 2 Score: 110.5 bits (275), Expect = 2.6e-21 Identity = 56/79 (70.89%), Postives = 62/79 (78.48%), Query Frame = 1
BLAST of MU54939 vs. TrEMBL
Match: A0A097PQF9_THECC (ABC1-like kinase (Fragment) OS=Theobroma cacao PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 1.9e-03 Identity = 25/33 (75.76%), Postives = 28/33 (84.85%), Query Frame = 3
HSP 2 Score: 110.5 bits (275), Expect = 2.6e-21 Identity = 56/79 (70.89%), Postives = 62/79 (78.48%), Query Frame = 1
BLAST of MU54939 vs. TrEMBL
Match: A0A061FSI1_THECC (Kinase superfamily protein isoform 1 OS=Theobroma cacao GN=TCM_045616 PE=4 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 2.2e-04 Identity = 27/41 (65.85%), Postives = 32/41 (78.05%), Query Frame = 3
HSP 2 Score: 109.0 bits (271), Expect = 7.5e-21 Identity = 55/79 (69.62%), Postives = 65/79 (82.28%), Query Frame = 1
BLAST of MU54939 vs. TAIR10
Match: AT1G79600.1 (AT1G79600.1 Protein kinase superfamily protein) HSP 1 Score: 104.4 bits (259), Expect = 9.4e-23 Identity = 51/79 (64.56%), Postives = 61/79 (77.22%), Query Frame = 1
HSP 2 Score: 56.2 bits (134), Expect = 2.9e-08 Identity = 28/40 (70.00%), Postives = 30/40 (75.00%), Query Frame = 3
BLAST of MU54939 vs. NCBI nr
Match: gi|659099243|ref|XP_008450502.1| (PREDICTED: uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic [Cucumis melo]) HSP 1 Score: 159.8 bits (403), Expect = 5.3e-36 Identity = 79/79 (100.00%), Postives = 79/79 (100.00%), Query Frame = 1
BLAST of MU54939 vs. NCBI nr
Match: gi|449435585|ref|XP_004135575.1| (PREDICTED: uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic [Cucumis sativus]) HSP 1 Score: 156.8 bits (395), Expect = 4.5e-35 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = 1
BLAST of MU54939 vs. NCBI nr
Match: gi|502146484|ref|XP_004506473.1| (PREDICTED: uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic-like [Cicer arietinum]) HSP 1 Score: 115.2 bits (287), Expect = 1.5e-22 Identity = 53/79 (67.09%), Postives = 66/79 (83.54%), Query Frame = 1
BLAST of MU54939 vs. NCBI nr
Match: gi|700257455|gb|AIU50334.1| (ABC1-like kinase, partial [Platanus x acerifolia]) HSP 1 Score: 114.4 bits (285), Expect = 2.6e-22 Identity = 59/79 (74.68%), Postives = 63/79 (79.75%), Query Frame = 1
BLAST of MU54939 vs. NCBI nr
Match: gi|1009126162|ref|XP_015880003.1| (PREDICTED: uncharacterized aarF domain-containing protein kinase At1g79600, chloroplastic isoform X1 [Ziziphus jujuba]) HSP 1 Score: 112.8 bits (281), Expect = 7.5e-22 Identity = 52/79 (65.82%), Postives = 64/79 (81.01%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|