MU53895 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AAGGAGCGAGGTCAGTAAAGAATATGGGTGTCACAAAGGAGCAACTCGAATCTACTTTAACTTCTAACTTGAATCCTCAACATCTGGAGGTAACTGATACATCTGGAGGGAAAAAGGTTGCTTGAACGACATCGGTTAGTGAATGCTGCTTTGGTGGAGGAAATGAAAGAGATTCATGCTCTTTCCATCAAGAAGGCTCTGACCCCACAACAATGGAAGCAACAACAAGAAGAATCTGAGAAATCAAAGTCTGCAGCTTAGAGAATGGTTTATAAGTAAAGTAAGAGCCATTGATAAATAAAGCATACCATAAAGCCTTTACAGTGATGGTGTAATCCTGATTCTGCTGTACTTGTGTATGAAAGTTTCTGCTTTTGAGTTTGT
BLAST of MU53895 vs. Swiss-Prot
Match: BOLA2_ARATH (Protein BOLA2 OS=Arabidopsis thaliana GN=BOLA2 PE=1 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 1.2e-11 Identity = 34/37 (91.89%), Postives = 33/37 (89.19%), Query Frame = 1
HSP 2 Score: 40.8 bits (94), Expect = 1.3e-02 Identity = 19/27 (70.37%), Postives = 20/27 (74.07%), Query Frame = 3
BLAST of MU53895 vs. TrEMBL
Match: A0A0A0LM73_CUCSA (Transcription regulator OS=Cucumis sativus GN=Csa_2G301520 PE=3 SV=1) HSP 1 Score: 75.1 bits (183), Expect = 6.9e-11 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of MU53895 vs. TrEMBL
Match: A0A0A0LM73_CUCSA (Transcription regulator OS=Cucumis sativus GN=Csa_2G301520 PE=3 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 5.1e-06 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = 3
HSP 2 Score: 72.8 bits (177), Expect = 3.4e-10 Identity = 34/37 (91.89%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of MU53895 vs. TrEMBL
Match: F4YF98_CAMSI (Bola-like family protein OS=Camellia sinensis PE=2 SV=1) HSP 1 Score: 46.2 bits (108), Expect = 3.4e-02 Identity = 21/29 (72.41%), Postives = 25/29 (86.21%), Query Frame = 3
HSP 2 Score: 72.8 bits (177), Expect = 3.4e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of MU53895 vs. TrEMBL
Match: B9GGS2_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0001s31670g PE=3 SV=2) HSP 1 Score: 48.9 bits (115), Expect = 5.3e-03 Identity = 23/29 (79.31%), Postives = 24/29 (82.76%), Query Frame = 3
HSP 2 Score: 72.0 bits (175), Expect = 5.9e-10 Identity = 34/37 (91.89%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of MU53895 vs. TrEMBL
Match: A0A059AKB7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_I00245 PE=3 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 6.2e-04 Identity = 24/29 (82.76%), Postives = 26/29 (89.66%), Query Frame = 3
HSP 2 Score: 70.9 bits (172), Expect = 1.3e-09 Identity = 34/37 (91.89%), Postives = 35/37 (94.59%), Query Frame = 1
BLAST of MU53895 vs. TAIR10
Match: AT5G09830.1 (AT5G09830.1 BolA-like family protein) HSP 1 Score: 70.9 bits (172), Expect = 6.6e-13 Identity = 34/37 (91.89%), Postives = 33/37 (89.19%), Query Frame = 1
HSP 2 Score: 40.8 bits (94), Expect = 7.3e-04 Identity = 19/27 (70.37%), Postives = 20/27 (74.07%), Query Frame = 3
BLAST of MU53895 vs. NCBI nr
Match: gi|659121976|ref|XP_008460912.1| (PREDICTED: uncharacterized bolA-like protein C8C9.11 [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 5.8e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of MU53895 vs. NCBI nr
Match: gi|449459240|ref|XP_004147354.1| (PREDICTED: protein BOLA2 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 1.3e-10 Identity = 36/37 (97.30%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of MU53895 vs. NCBI nr
Match: gi|743904662|ref|XP_011045711.1| (PREDICTED: uncharacterized bolA-like protein C8C9.11 [Populus euphratica]) HSP 1 Score: 72.4 bits (176), Expect = 6.5e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of MU53895 vs. NCBI nr
Match: gi|566152075|ref|XP_002300203.2| (hypothetical protein POPTR_0001s31670g [Populus trichocarpa]) HSP 1 Score: 72.4 bits (176), Expect = 6.5e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of MU53895 vs. NCBI nr
Match: gi|330318580|gb|AEC10959.1| (bola-like family protein [Camellia sinensis]) HSP 1 Score: 72.4 bits (176), Expect = 6.5e-10 Identity = 34/37 (91.89%), Postives = 36/37 (97.30%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|