MU53410 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
ATTGATTGAAAGTTGGGAAACCTTACGAGATGTGATGCTTGGAATGTTCACAAATGATCGACTTATTGAAAAGGTTAACGAAATGAACCTAAAGTTACATGCTTTAGTTATGGCTCTACCTGAAGCAGAGAGAATTTACTTACTTGAAAAGGAGAAAGCGAGGAAAAAGGACTTGTTAGAAATACATGATCATTCTCCATAGCCACCTGAAAGAGCAGATGTATTTAGAAATTTTATACATATCTTGTAATTTCTAAGATCCTTTCACCATAACTAAAAGTTACTTGAAAGTTATCCCAAGACTTCATGAGTGTTAGTTCACCAGATCTAGTGGTCCTGTTGTGTGGGCAACAGTTTAAAGTTAATTGTTTATGTCCTGAGAGTAAGGGAAGCTTTTTTTGATCCTTGGTTTTGTGAACTGTCACCCATAAATACAAACATAGCAGGAGGCTGAATTTGTTGTTATGAATCAATAAACAAAAAAGATTCTGTC
BLAST of MU53410 vs. Swiss-Prot
Match: DUR3_ARATH (Urea-proton symporter DUR3 OS=Arabidopsis thaliana GN=DUR3 PE=1 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 9.4e-14 Identity = 33/57 (57.89%), Postives = 47/57 (82.46%), Query Frame = 2
BLAST of MU53410 vs. TrEMBL
Match: A0A0A0L3R6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G004500 PE=3 SV=1) HSP 1 Score: 129.4 bits (324), Expect = 4.0e-27 Identity = 64/66 (96.97%), Postives = 64/66 (96.97%), Query Frame = 2
BLAST of MU53410 vs. TrEMBL
Match: B9GZX7_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0003s10300g PE=3 SV=2) HSP 1 Score: 93.6 bits (231), Expect = 2.4e-16 Identity = 41/57 (71.93%), Postives = 54/57 (94.74%), Query Frame = 2
BLAST of MU53410 vs. TrEMBL
Match: U5D087_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00048p00195780 PE=3 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 1.2e-15 Identity = 40/60 (66.67%), Postives = 54/60 (90.00%), Query Frame = 2
BLAST of MU53410 vs. TrEMBL
Match: W9RI82_9ROSA (Putative urea active transporter 1 OS=Morus notabilis GN=L484_025992 PE=3 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 1.6e-15 Identity = 38/79 (48.10%), Postives = 61/79 (77.22%), Query Frame = 2
BLAST of MU53410 vs. TrEMBL
Match: D7U403_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_02s0033g01370 PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 2.0e-15 Identity = 39/65 (60.00%), Postives = 55/65 (84.62%), Query Frame = 2
BLAST of MU53410 vs. TAIR10
Match: AT5G45380.1 (AT5G45380.1 solute:sodium symporters;urea transmembrane transporters) HSP 1 Score: 78.2 bits (191), Expect = 5.3e-15 Identity = 33/57 (57.89%), Postives = 47/57 (82.46%), Query Frame = 2
BLAST of MU53410 vs. NCBI nr
Match: gi|659095440|ref|XP_008448582.1| (PREDICTED: urea-proton symporter DUR3 [Cucumis melo]) HSP 1 Score: 132.1 bits (331), Expect = 8.8e-28 Identity = 66/66 (100.00%), Postives = 66/66 (100.00%), Query Frame = 2
BLAST of MU53410 vs. NCBI nr
Match: gi|449456915|ref|XP_004146194.1| (PREDICTED: urea-proton symporter DUR3 [Cucumis sativus]) HSP 1 Score: 127.9 bits (320), Expect = 1.7e-26 Identity = 64/66 (96.97%), Postives = 64/66 (96.97%), Query Frame = 2
BLAST of MU53410 vs. NCBI nr
Match: gi|694379094|ref|XP_009365758.1| (PREDICTED: urea-proton symporter DUR3-like [Pyrus x bretschneideri]) HSP 1 Score: 97.4 bits (241), Expect = 2.4e-17 Identity = 45/65 (69.23%), Postives = 58/65 (89.23%), Query Frame = 2
BLAST of MU53410 vs. NCBI nr
Match: gi|657963710|ref|XP_008373474.1| (PREDICTED: urea-proton symporter DUR3 [Malus domestica]) HSP 1 Score: 97.4 bits (241), Expect = 2.4e-17 Identity = 45/65 (69.23%), Postives = 58/65 (89.23%), Query Frame = 2
BLAST of MU53410 vs. NCBI nr
Match: gi|694379096|ref|XP_009365760.1| (PREDICTED: urea-proton symporter DUR3-like [Pyrus x bretschneideri]) HSP 1 Score: 97.4 bits (241), Expect = 2.4e-17 Identity = 45/65 (69.23%), Postives = 58/65 (89.23%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|