MU52925 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GCCCAATCCCTTTAGCGCATTCAATCCCCCTTCGACAGTTCGACGTTCACATTTCGGCGATAAGATTCCGGCGACCTTTACATTCCGCCGCCGGCCTTTGCACATTTAGATCGTAAGTTCGACGGCACGATTCGCCTTTACACGTTCCAATCGCAAGTTCGACTGCACGTTCAGATCGCAAGTTCGACGGACTTCACATTTTGGGTTCTTCATCTTGTGTTGTCGGGTTCTTCATCTTGTTTTGTCCAAGCAATGGAACATGGATCCTTTACAGATGAGACCAAATCAACATTTTCTATGGCTGATGAAGATCATACACTTGCAAATGCTCTCAGATACACTTTGAATCAAGAGTAGGAGCTCTTATTCAGTTATTCTTGAGTGAATACTTTGAAATGTCAACGCTCATTTTTTTTAACCATTTCATCTTGCTATTAATTCATGACATTAATAATTAAGTAGATTCTTGGTTCTTGTGAACATATAATTCACAAGGTCCTTAAAGAATTATTTAGGTTCTTGGATAATCCATGAGGCATAAATTGATAAATAATGTACAGCCATTGCATGCGTTAATGTGCGTTCTTTCATTGTCC
BLAST of MU52925 vs. TrEMBL
Match: A0A0A0LUT5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G095010 PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 5.9e-09 Identity = 32/39 (82.05%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of MU52925 vs. TrEMBL
Match: A0A0A0LV21_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G527910 PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 7.7e-09 Identity = 33/39 (84.62%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of MU52925 vs. TrEMBL
Match: W9QP58_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_006039 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 3.2e-07 Identity = 28/40 (70.00%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of MU52925 vs. TrEMBL
Match: K7MV80_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_18G281100 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 5.5e-07 Identity = 27/40 (67.50%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of MU52925 vs. TrEMBL
Match: A0A0B2PXJ1_GLYSO (DNA-directed RNA polymerases I and III subunit RPAC2 OS=Glycine soja GN=glysoja_016099 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 5.5e-07 Identity = 27/40 (67.50%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of MU52925 vs. NCBI nr
Match: gi|659115158|ref|XP_008457416.1| (PREDICTED: DNA-directed RNA polymerases I and III subunit RPAC2 [Cucumis melo]) HSP 1 Score: 72.0 bits (175), Expect = 1.3e-09 Identity = 34/39 (87.18%), Postives = 36/39 (92.31%), Query Frame = 1
BLAST of MU52925 vs. NCBI nr
Match: gi|778659017|ref|XP_004147276.2| (PREDICTED: DNA-directed RNA polymerases I and III subunit RPAC2 [Cucumis sativus]) HSP 1 Score: 68.9 bits (167), Expect = 1.1e-08 Identity = 32/39 (82.05%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of MU52925 vs. NCBI nr
Match: gi|449455052|ref|XP_004145267.1| (PREDICTED: DNA-directed RNA polymerases I and III subunit RPAC2 [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 1.4e-08 Identity = 33/39 (84.62%), Postives = 35/39 (89.74%), Query Frame = 1
BLAST of MU52925 vs. NCBI nr
Match: gi|703067178|ref|XP_010087903.1| (hypothetical protein L484_006039 [Morus notabilis]) HSP 1 Score: 63.2 bits (152), Expect = 6.1e-07 Identity = 28/40 (70.00%), Postives = 35/40 (87.50%), Query Frame = 1
BLAST of MU52925 vs. NCBI nr
Match: gi|947051972|gb|KRH01501.1| (hypothetical protein GLYMA_18G281100 [Glycine max]) HSP 1 Score: 62.4 bits (150), Expect = 1.0e-06 Identity = 27/40 (67.50%), Postives = 35/40 (87.50%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|