MU52034 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AACCAACCACATAAAGCCTTTTTTTTTTCTTGTTCTTCACCGATTTCTCTCTGCTGACTTTGGTTTGAAGCTCTCAGCCACCTCCATTAATGGCGTCCTTCTTCAGTTCTTGCACATCAATTTCTTCCCTGAAAATACCCACCTCTCCTCTGTCCTCTCAAACCCAAACTCTTTTGCCTTTTAATCTCTCACTATCACAATCTCTCTCTTCTCCGACATTACGATCTTCATCATCCGTCTCAATTACCTCCAACAACTCCACAATCACATCACTTCTCTTCAAAAAATCCAAACCCAACTCAGATCCTCCCAAATCCGGTAACTTCCACCTATTTTTATTTCCCATCTTCATCATATTAGTTTAATTACACATGTAAAATTGATGTTTTTTAGTCGATCCATTAACTTTCCGGACGATGAACCAAACATATCTTCACAGATTTGTCGTCAGATACAAAAGTGGAGCATTTGATAAATTTATTGAAGTTTTAATAGTACCTATATTTTCAAATTTTTGTTCATTTTAATGCTTCTATTTCAAAATGTTTATTTTAGTTAGTAAAGATTAAGAGGTAGATTTAATTATATATTGTAACTGAAGTAATTGAAGTTGGAATGTAGGCATGGTTAAGGCGTTTGGTTGAACTAATAAATGTTTTGGTTGTTCAGCAAAAGTACAGGAACTGTTCGTGTACGAGATAAACGAGCGAGACAGGGGAAGCCCAGCATTCCTAAAACTAAGCAAGAAGGCTGAGAATTCACTGGGGGATTTGGTTCCATTCAGCAACAAGCTCTACTCCGGCGACCTTCAGAAGCGGCTGGGCATAACGGCCGGCCTCTGCGTC
BLAST of MU52034 vs. Swiss-Prot
Match: AOC3_ARATH (Allene oxide cyclase 3, chloroplastic OS=Arabidopsis thaliana GN=AOC3 PE=2 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 2.7e-16 Identity = 44/60 (73.33%), Postives = 49/60 (81.67%), Query Frame = 3
BLAST of MU52034 vs. Swiss-Prot
Match: AOC4_ARATH (Allene oxide cyclase 4, chloroplastic OS=Arabidopsis thaliana GN=AOC4 PE=2 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 1.0e-15 Identity = 43/59 (72.88%), Postives = 46/59 (77.97%), Query Frame = 3
BLAST of MU52034 vs. Swiss-Prot
Match: AOC2_ARATH (Allene oxide cyclase 2, chloroplastic OS=Arabidopsis thaliana GN=AOC2 PE=1 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 1.9e-14 Identity = 41/59 (69.49%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of MU52034 vs. Swiss-Prot
Match: AOC1_ARATH (Allene oxide cyclase 1, chloroplastic OS=Arabidopsis thaliana GN=AOC1 PE=1 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 3.3e-14 Identity = 40/59 (67.80%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of MU52034 vs. TrEMBL
Match: A0A0A0KRE5_CUCSA (Allene oxide cyclase OS=Cucumis sativus GN=Csa_5G366670 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 2.0e-23 Identity = 58/60 (96.67%), Postives = 59/60 (98.33%), Query Frame = 3
BLAST of MU52034 vs. TrEMBL
Match: U5KFT4_CATRO (Allene oxide cyclase OS=Catharanthus roseus PE=2 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 3.3e-21 Identity = 54/58 (93.10%), Postives = 56/58 (96.55%), Query Frame = 3
BLAST of MU52034 vs. TrEMBL
Match: A0A0B2PTF0_GLYSO (Allene oxide cyclase 4, chloroplastic OS=Glycine soja GN=glysoja_034143 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 5.6e-21 Identity = 53/59 (89.83%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of MU52034 vs. TrEMBL
Match: F6KBT1_SOYBN (Allene oxide cyclase 1 OS=Glycine max GN=AOC1 PE=2 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 5.6e-21 Identity = 53/59 (89.83%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of MU52034 vs. TrEMBL
Match: F6KBT2_SOYBN (Allene oxide cyclase 2 OS=Glycine max GN=AOC2 PE=2 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 7.3e-21 Identity = 53/58 (91.38%), Postives = 56/58 (96.55%), Query Frame = 3
BLAST of MU52034 vs. TAIR10
Match: AT3G25780.1 (AT3G25780.1 allene oxide cyclase 3) HSP 1 Score: 87.4 bits (215), Expect = 1.5e-17 Identity = 44/60 (73.33%), Postives = 49/60 (81.67%), Query Frame = 3
BLAST of MU52034 vs. TAIR10
Match: AT1G13280.1 (AT1G13280.1 allene oxide cyclase 4) HSP 1 Score: 85.5 bits (210), Expect = 5.7e-17 Identity = 43/59 (72.88%), Postives = 46/59 (77.97%), Query Frame = 3
BLAST of MU52034 vs. TAIR10
Match: AT3G25770.1 (AT3G25770.1 allene oxide cyclase 2) HSP 1 Score: 81.3 bits (199), Expect = 1.1e-15 Identity = 41/59 (69.49%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of MU52034 vs. TAIR10
Match: AT3G25760.1 (AT3G25760.1 allene oxide cyclase 1) HSP 1 Score: 80.5 bits (197), Expect = 1.8e-15 Identity = 40/59 (67.80%), Postives = 45/59 (76.27%), Query Frame = 3
BLAST of MU52034 vs. NCBI nr
Match: gi|659131624|ref|XP_008465778.1| (PREDICTED: allene oxide cyclase 1, chloroplastic [Cucumis melo]) HSP 1 Score: 123.2 bits (308), Expect = 7.0e-25 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = 3
BLAST of MU52034 vs. NCBI nr
Match: gi|449445152|ref|XP_004140337.1| (PREDICTED: allene oxide cyclase 3, chloroplastic [Cucumis sativus]) HSP 1 Score: 120.6 bits (301), Expect = 4.5e-24 Identity = 58/60 (96.67%), Postives = 59/60 (98.33%), Query Frame = 3
BLAST of MU52034 vs. NCBI nr
Match: gi|743784198|ref|XP_011021732.1| (PREDICTED: allene oxide cyclase 3, chloroplastic-like [Populus euphratica]) HSP 1 Score: 113.2 bits (282), Expect = 7.2e-22 Identity = 54/59 (91.53%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of MU52034 vs. NCBI nr
Match: gi|525338010|gb|AGR49302.1| (allene oxide cyclase [Catharanthus roseus]) HSP 1 Score: 113.2 bits (282), Expect = 7.2e-22 Identity = 54/58 (93.10%), Postives = 56/58 (96.55%), Query Frame = 3
BLAST of MU52034 vs. NCBI nr
Match: gi|951053335|ref|XP_014520963.1| (PREDICTED: allene oxide cyclase 3, chloroplastic-like [Vigna radiata var. radiata]) HSP 1 Score: 112.5 bits (280), Expect = 1.2e-21 Identity = 54/59 (91.53%), Postives = 57/59 (96.61%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|