MU49147 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
AGGAAAAACAGTTGTGGCCGTGAGTTTCCTCCCGAACGAGACCTGCAACCCAACCCTCGAGAAAGAAACCCATTGTTCGGTTTTTCTGCAGTTGGTCTGATGCTTGGTTTCGAACGCATCTCCATAGCTCCCGGTGGAGTGGAGGGTTGCTGGAAGAGCCTTTGAGGTCAGGTTAAGGAATGAGTTGCCATTTGAAAAGTACGAGGCGGCCCAGATATACAATGCTTCATCGTGTTGATCGCTACGAGGATTTCAATTGTTAACCGTCAGCCGTAGAGGGTTGGTGCATCACAAAGGATTGAAAAGTATAGAGATGAACTAGAATGAGTAGATTGTCATTCAGGCCTCGTCCGCTTGACATTCACAAGAAACTCCCTATTGTCAAGTCTGTGAAAGAATTGGAAGATGAAGAAACCCCCACTTCTACCCGAAATTCCCAACTGCTTCGTGTTGCGGCCGAGGTAGATAACGAGGTACATCAAGTGCCTTGCAAGAAATTGGCTCCTGATATACCCACTCCTCAATTTGTTGTTGTTGATACTTATGAGATAGACTACTCCCGCACTTTTAGTCAACCAACTTCTTACTTACGTGGCAGAGGAGGTTGGTGACATATGGAGTACTGCTACTGTAGATATTTTTAGGCTCATTAACTTTTGTACCATTACCATTCCCGCGTGAATATGTACACATACTCTGTATTTGCAGCTCGGACAGAGCTTGGAGAGTTTGTTGAGTATGACTTGNACAATGA
BLAST of MU49147 vs. TrEMBL
Match: A0A0A0LW95_CUCSA (Enhancer of polycomb-like protein OS=Cucumis sativus GN=Csa_1G560800 PE=3 SV=1) HSP 1 Score: 189.5 bits (480), Expect = 4.9e-45 Identity = 93/93 (100.00%), Postives = 93/93 (100.00%), Query Frame = 3
BLAST of MU49147 vs. TrEMBL
Match: A0A0A0LW95_CUCSA (Enhancer of polycomb-like protein OS=Cucumis sativus GN=Csa_1G560800 PE=3 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 1.3e+03 Identity = 14/15 (93.33%), Postives = 14/15 (93.33%), Query Frame = 3
HSP 2 Score: 165.6 bits (418), Expect = 7.6e-38 Identity = 80/93 (86.02%), Postives = 87/93 (93.55%), Query Frame = 3
BLAST of MU49147 vs. TrEMBL
Match: D7TB57_VITVI (Enhancer of polycomb-like protein OS=Vitis vinifera GN=VIT_07s0130g00510 PE=3 SV=1) HSP 1 Score: 29.3 bits (64), Expect = 8.5e+03 Identity = 12/15 (80.00%), Postives = 13/15 (86.67%), Query Frame = 3
HSP 2 Score: 163.7 bits (413), Expect = 2.9e-37 Identity = 79/94 (84.04%), Postives = 88/94 (93.62%), Query Frame = 3
BLAST of MU49147 vs. TrEMBL
Match: A0A067L8B0_JATCU (Enhancer of polycomb-like protein OS=Jatropha curcas GN=JCGZ_01191 PE=3 SV=1) HSP 1 Score: 29.3 bits (64), Expect = 8.5e+03 Identity = 12/15 (80.00%), Postives = 13/15 (86.67%), Query Frame = 3
HSP 2 Score: 157.5 bits (397), Expect = 2.1e-35 Identity = 75/93 (80.65%), Postives = 82/93 (88.17%), Query Frame = 3
BLAST of MU49147 vs. TrEMBL
Match: A0A151REB9_CAJCA (Enhancer of polycomb-like protein OS=Cajanus cajan GN=KK1_037923 PE=3 SV=1) HSP 1 Score: 29.3 bits (64), Expect = 8.5e+03 Identity = 12/15 (80.00%), Postives = 13/15 (86.67%), Query Frame = 3
HSP 2 Score: 154.5 bits (389), Expect = 1.8e-34 Identity = 80/95 (84.21%), Postives = 85/95 (89.47%), Query Frame = 3
BLAST of MU49147 vs. TAIR10
Match: AT1G79020.1 (AT1G79020.1 Enhancer of polycomb-like transcription factor protein) HSP 1 Score: 142.9 bits (359), Expect = 2.7e-34 Identity = 74/95 (77.89%), Postives = 79/95 (83.16%), Query Frame = 3
HSP 2 Score: 30.4 bits (67), Expect = 1.9e+00 Identity = 13/15 (86.67%), Postives = 12/15 (80.00%), Query Frame = 3
BLAST of MU49147 vs. TAIR10
Match: AT1G16690.1 (AT1G16690.1 Enhancer of polycomb-like transcription factor protein) HSP 1 Score: 134.4 bits (337), Expect = 9.5e-32 Identity = 71/97 (73.20%), Postives = 79/97 (81.44%), Query Frame = 3
HSP 2 Score: 30.0 bits (66), Expect = 2.5e+00 Identity = 13/15 (86.67%), Postives = 11/15 (73.33%), Query Frame = 3
BLAST of MU49147 vs. NCBI nr
Match: gi|449435587|ref|XP_004135576.1| (PREDICTED: uncharacterized protein LOC101217797 [Cucumis sativus]) HSP 1 Score: 190.3 bits (482), Expect = 4.1e-45 Identity = 93/93 (100.00%), Postives = 93/93 (100.00%), Query Frame = 3
BLAST of MU49147 vs. NCBI nr
Match: gi|659099233|ref|XP_008450499.1| (PREDICTED: enhancer of polycomb-like protein 1 [Cucumis melo]) HSP 1 Score: 190.3 bits (482), Expect = 4.1e-45 Identity = 93/93 (100.00%), Postives = 93/93 (100.00%), Query Frame = 3
BLAST of MU49147 vs. NCBI nr
Match: gi|225463149|ref|XP_002266845.1| (PREDICTED: uncharacterized protein LOC100264813 [Vitis vinifera]) HSP 1 Score: 166.4 bits (420), Expect = 6.4e-38 Identity = 80/93 (86.02%), Postives = 87/93 (93.55%), Query Frame = 3
BLAST of MU49147 vs. NCBI nr
Match: gi|802546720|ref|XP_012086614.1| (PREDICTED: uncharacterized protein LOC105645584 [Jatropha curcas]) HSP 1 Score: 164.5 bits (415), Expect = 2.4e-37 Identity = 79/94 (84.04%), Postives = 88/94 (93.62%), Query Frame = 3
BLAST of MU49147 vs. NCBI nr
Match: gi|1012329146|gb|KYP40745.1| (hypothetical protein KK1_037923 [Cajanus cajan]) HSP 1 Score: 158.3 bits (399), Expect = 1.7e-35 Identity = 75/93 (80.65%), Postives = 82/93 (88.17%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|