MU48910 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
CTCAAATGGCTTCTTCTAACTCTACACTATTCTTCCCCTTGTTTTGCATATTGGGTTTGCTGGTGGGACACTCTTTGGCTCAACTAAACCCTTTGTTTTACGCCAAAACATGTCCTAATCTACCCAATATTGTGAATGCTGTCGTTGCAAAGGCTCTCCAAACCGATGCTCGAGCTGGAGCCAAGCTAATTCGTCTCCATTTTCATGACTGCTTTGTTGACGTACCTAACTAGTTAACAACAAATCTCAGTTTCAATTTTATATTTTTATGTTTAAAAAGAAAGATTGATGCGAGATGTGGGTAATATTTTTGCAGGGGTGTGATGCGTCTGTTTTGCT
BLAST of MU48910 vs. Swiss-Prot
Match: PER54_ARATH (Peroxidase 54 OS=Arabidopsis thaliana GN=PER54 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 9.3e-13 Identity = 41/76 (53.95%), Postives = 48/76 (63.16%), Query Frame = 3
BLAST of MU48910 vs. Swiss-Prot
Match: PER15_IPOBA (Peroxidase 15 OS=Ipomoea batatas GN=pod PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.6e-12 Identity = 37/67 (55.22%), Postives = 42/67 (62.69%), Query Frame = 3
BLAST of MU48910 vs. Swiss-Prot
Match: PER53_ARATH (Peroxidase 53 OS=Arabidopsis thaliana GN=PER53 PE=1 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.5e-12 Identity = 34/61 (55.74%), Postives = 40/61 (65.57%), Query Frame = 3
BLAST of MU48910 vs. Swiss-Prot
Match: PERX_TOBAC (Lignin-forming anionic peroxidase OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 2.3e-11 Identity = 34/64 (53.12%), Postives = 41/64 (64.06%), Query Frame = 3
BLAST of MU48910 vs. Swiss-Prot
Match: PER1A_ARMRU (Peroxidase C1A OS=Armoracia rusticana GN=PRXC1A PE=1 SV=2) HSP 1 Score: 69.3 bits (168), Expect = 3.0e-11 Identity = 36/75 (48.00%), Postives = 45/75 (60.00%), Query Frame = 3
BLAST of MU48910 vs. TrEMBL
Match: A0A0A0KZ68_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_4G285800 PE=3 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 2.0e-30 Identity = 67/72 (93.06%), Postives = 68/72 (94.44%), Query Frame = 3
BLAST of MU48910 vs. TrEMBL
Match: A0A0A0KWW3_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_4G285760 PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 9.1e-15 Identity = 42/73 (57.53%), Postives = 53/73 (72.60%), Query Frame = 3
BLAST of MU48910 vs. TrEMBL
Match: U5FKA6_POPTR (Peroxidase OS=Populus trichocarpa GN=PRX81 PE=2 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.3e-13 Identity = 41/73 (56.16%), Postives = 54/73 (73.97%), Query Frame = 3
BLAST of MU48910 vs. TrEMBL
Match: A0A0A0KZ63_CUCSA (Peroxidase OS=Cucumis sativus GN=Csa_4G285750 PE=3 SV=1) HSP 1 Score: 83.2 bits (204), Expect = 2.2e-13 Identity = 43/72 (59.72%), Postives = 52/72 (72.22%), Query Frame = 3
BLAST of MU48910 vs. TrEMBL
Match: Q6UBM4_CUCME (Peroxidase OS=Cucumis melo PE=2 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 5.0e-13 Identity = 39/71 (54.93%), Postives = 51/71 (71.83%), Query Frame = 3
BLAST of MU48910 vs. TAIR10
Match: AT5G06730.1 (AT5G06730.1 Peroxidase superfamily protein) HSP 1 Score: 74.3 bits (181), Expect = 5.2e-14 Identity = 41/76 (53.95%), Postives = 48/76 (63.16%), Query Frame = 3
BLAST of MU48910 vs. TAIR10
Match: AT5G06720.1 (AT5G06720.1 peroxidase 2) HSP 1 Score: 72.4 bits (176), Expect = 2.0e-13 Identity = 34/61 (55.74%), Postives = 40/61 (65.57%), Query Frame = 3
BLAST of MU48910 vs. TAIR10
Match: AT3G49120.1 (AT3G49120.1 peroxidase CB) HSP 1 Score: 68.2 bits (165), Expect = 3.8e-12 Identity = 32/74 (43.24%), Postives = 46/74 (62.16%), Query Frame = 3
BLAST of MU48910 vs. TAIR10
Match: AT4G08780.1 (AT4G08780.1 Peroxidase superfamily protein) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-11 Identity = 31/60 (51.67%), Postives = 39/60 (65.00%), Query Frame = 3
BLAST of MU48910 vs. TAIR10
Match: AT4G08770.1 (AT4G08770.1 Peroxidase superfamily protein) HSP 1 Score: 63.9 bits (154), Expect = 7.1e-11 Identity = 29/60 (48.33%), Postives = 38/60 (63.33%), Query Frame = 3
BLAST of MU48910 vs. NCBI nr
Match: gi|659097709|ref|XP_008449771.1| (PREDICTED: peroxidase 2-like [Cucumis melo]) HSP 1 Score: 151.4 bits (381), Expect = 9.6e-34 Identity = 73/73 (100.00%), Postives = 73/73 (100.00%), Query Frame = 3
BLAST of MU48910 vs. NCBI nr
Match: gi|449448782|ref|XP_004142144.1| (PREDICTED: peroxidase 2-like [Cucumis sativus]) HSP 1 Score: 140.6 bits (353), Expect = 1.7e-30 Identity = 67/73 (91.78%), Postives = 69/73 (94.52%), Query Frame = 3
BLAST of MU48910 vs. NCBI nr
Match: gi|700198946|gb|KGN54104.1| (hypothetical protein Csa_4G285800 [Cucumis sativus]) HSP 1 Score: 139.8 bits (351), Expect = 2.9e-30 Identity = 67/72 (93.06%), Postives = 68/72 (94.44%), Query Frame = 3
BLAST of MU48910 vs. NCBI nr
Match: gi|700198942|gb|KGN54100.1| (hypothetical protein Csa_4G285760 [Cucumis sativus]) HSP 1 Score: 88.2 bits (217), Expect = 9.9e-15 Identity = 42/73 (57.53%), Postives = 53/73 (72.60%), Query Frame = 3
BLAST of MU48910 vs. NCBI nr
Match: gi|449467745|ref|XP_004151583.1| (PREDICTED: peroxidase 2-like [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.7e-14 Identity = 42/72 (58.33%), Postives = 52/72 (72.22%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|