MU48492 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
TGACCTACTGAATGAACACTTCTTGTCATTTCATTTAACAATGATTACGTATCTAAATGTTGCTGCCACAGGCCCCGGGAAATCCACAGAAGTTGAAAGCTGTGGAGATAGCTGCTGCTTATTCTTCCCTTTCGTTTGGAATGGGTTACTTTGCAAGCTCTATGGATCGACCCAAGGTGTCCATTTTGCGGAGTACAAAACAAAACAATAAGATGGGAATTGATCATTTTGAAGCACGTGTAGATCTTTCAGACAATAGGAAGCTCTAATAAACCCAGAAAGGAAATGCAAGAATTAAGCCAAGGCTTTCTCTTTCTCCATCACGATTCAATTCCACAGAGAAAAGGTCACAATTGTTAAAAATTTTCATACCGTTTTATTATTACAGAACAATTTGAAGATGCTGAACTTAAAAAATTAGGTTCAGATTAGATGCTATTCTAATTCGAGGTTTTAGTTTTTAATTTATTGGATGGGTATGGGGTTGATTGGTGATTATGGATGCACCAAAATGAAAAAGAAGGGGAATCTGGTACTATAGTTTATTTAGTAAGAGGAGCTAATAGCAATTGAGTGGTTACGATGGGAAATTGATGAAACTTTTGATCAAAGAAAAACAAAAGTTCAA
BLAST of MU48492 vs. Swiss-Prot
Match: TASP1_ARATH (Putative threonine aspartase OS=Arabidopsis thaliana GN=At4g00590 PE=2 SV=3) HSP 1 Score: 82.4 bits (202), Expect = 6.3e-15 Identity = 36/58 (62.07%), Postives = 49/58 (84.48%), Query Frame = 3
BLAST of MU48492 vs. TrEMBL
Match: A0A0A0L7I2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G122610 PE=4 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 3.6e-25 Identity = 61/65 (93.85%), Postives = 63/65 (96.92%), Query Frame = 3
BLAST of MU48492 vs. TrEMBL
Match: A0A0B0PI15_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_06242 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 3.3e-18 Identity = 47/61 (77.05%), Postives = 54/61 (88.52%), Query Frame = 3
BLAST of MU48492 vs. TrEMBL
Match: A0A0B0PJK3_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_06242 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 3.3e-18 Identity = 47/61 (77.05%), Postives = 54/61 (88.52%), Query Frame = 3
BLAST of MU48492 vs. TrEMBL
Match: A0A067KA23_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_14430 PE=4 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 7.3e-18 Identity = 47/60 (78.33%), Postives = 55/60 (91.67%), Query Frame = 3
BLAST of MU48492 vs. TrEMBL
Match: A0A061DTG3_THECC (N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein OS=Theobroma cacao GN=TCM_005380 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 9.5e-18 Identity = 47/64 (73.44%), Postives = 53/64 (82.81%), Query Frame = 3
BLAST of MU48492 vs. TAIR10
Match: AT4G00590.1 (AT4G00590.1 N-terminal nucleophile aminohydrolases (Ntn hydrolases) superfamily protein) HSP 1 Score: 82.4 bits (202), Expect = 3.6e-16 Identity = 36/58 (62.07%), Postives = 49/58 (84.48%), Query Frame = 3
BLAST of MU48492 vs. NCBI nr
Match: gi|659075307|ref|XP_008438075.1| (PREDICTED: putative threonine aspartase isoform X2 [Cucumis melo]) HSP 1 Score: 131.7 bits (330), Expect = 1.5e-27 Identity = 64/65 (98.46%), Postives = 65/65 (100.00%), Query Frame = 3
BLAST of MU48492 vs. NCBI nr
Match: gi|659075309|ref|XP_008438076.1| (PREDICTED: putative threonine aspartase isoform X3 [Cucumis melo]) HSP 1 Score: 131.7 bits (330), Expect = 1.5e-27 Identity = 64/65 (98.46%), Postives = 65/65 (100.00%), Query Frame = 3
BLAST of MU48492 vs. NCBI nr
Match: gi|659075305|ref|XP_008438074.1| (PREDICTED: putative threonine aspartase isoform X1 [Cucumis melo]) HSP 1 Score: 131.7 bits (330), Expect = 1.5e-27 Identity = 64/65 (98.46%), Postives = 65/65 (100.00%), Query Frame = 3
BLAST of MU48492 vs. NCBI nr
Match: gi|778677269|ref|XP_011650762.1| (PREDICTED: putative threonine aspartase isoform X2 [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 1.8e-25 Identity = 61/65 (93.85%), Postives = 63/65 (96.92%), Query Frame = 3
BLAST of MU48492 vs. NCBI nr
Match: gi|700201404|gb|KGN56537.1| (hypothetical protein Csa_3G122610 [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 1.8e-25 Identity = 61/65 (93.85%), Postives = 63/65 (96.92%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|