|
The following sequences are available for this feature:
transcribed_cluster sequence ATCCCATCGCAAAGCCCTCAAAACCATGGCAGAAGAAGAGCAAGGCCATCACCATCACCACCTTTTCCACCACCACAAGGAAGGAGAAGAGAGCTCTGATGTTGTCGACTACAAGAAAGAGAAGAAGCACCACAAGCACCTCGAACACCTTGGTGAGCTCGGTGCCGCCGCAGCCGGTGCCTATGCTCTGCATGAGAAGCACGAGGCGAAAAAAGACAGCGAACACAGCCATGAGCACAAGATCAAGGAGGAAGTTGGAGCGGCGGTGGTGGCTGGGGCCGGGGAATTTGTGCTCTATGAGCATCATAAAGAAAAGGAAGCAAAGAGAGAAGAGAAAGAGGCTAATGGAAAGGAACATCACCACCATCTTTTTTGAAAAACTTTGCCTTTCATATTTATATATGATGGGGTTTAATTGTTTGCTTTTCTTTTGGCTTTGTTTGTGATGTTTTGGGTTTTAAGAGTTTAATCTATTAAGTGGTTTGTAAAATAAATTTGAAATGCTCAAGCAAATAAGAAGATTGAGAATATGTGTTCTGTGTGCC
The following BLAST results are available for this feature:
Match Name | E-value | Identity | Description | |
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
Term | Definition |
IPR003496 | ABA_WDS |
Vocabulary: Biological Process
Term | Definition |
GO:0006950 | response to stress |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
Category |
Term Accession |
Term Name |
biological_process |
GO:0006950 |
response to stress |
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
IPR003496 | ABA/WDS induced protein | PFAM | PF02496 | ABA_WDS | coord: 28..105 score: 6.4 |
None | No IPR available | PANTHER | PTHR33801 | FAMILY NOT NAMED | coord: 1..116 score: 6.2 |
None | No IPR available | PANTHER | PTHR33801:SF7 | SUBFAMILY NOT NAMED | coord: 1..116 score: 6.2 |
|