CU178214 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACAAAACCCATTTCCAGAATTTTGTCAAATGTGTTGAGCTCATCCATTTTGCTAAAAACCTCACAAAGATTTCTTTTCTTTCTTGGTGGTTTTGTTTTGGAGAGAAATAATAATGGAGGGAGGAATTCATGGGGGAAGCAGCAATAGTGATGATGGTTCTTCAACTTTTAGAGATTGTTTTTCTTTGGCTTGGAAAAATCCATATGTTCTTCGTCTTGCCTTTTCTGCTGGAATTGGTGGCTTTCTTTTTGGCTATGACACTGGAGTCATTTCTGGAGCTCTTCTTTACATTAGGGATGACTTCAAGTCTGTGGACAGCAGCACTGTTTTAC
BLAST of CU178214 vs. Swiss-Prot
Match: INT2_ARATH (Probable inositol transporter 2 OS=Arabidopsis thaliana GN=INT2 PE=1 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 2.4e-21 Identity = 48/55 (87.27%), Postives = 50/55 (90.91%), Query Frame = 2
BLAST of CU178214 vs. Swiss-Prot
Match: INT4_ARATH (Inositol transporter 4 OS=Arabidopsis thaliana GN=INT4 PE=1 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 4.4e-15 Identity = 36/55 (65.45%), Postives = 41/55 (74.55%), Query Frame = 2
BLAST of CU178214 vs. Swiss-Prot
Match: INT3_ARATH (Probable inositol transporter 3 OS=Arabidopsis thaliana GN=INT3 PE=2 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.5e-12 Identity = 31/53 (58.49%), Postives = 41/53 (77.36%), Query Frame = 2
BLAST of CU178214 vs. Swiss-Prot
Match: INT1_ARATH (Inositol transporter 1 OS=Arabidopsis thaliana GN=INT1 PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.2e-10 Identity = 31/45 (68.89%), Postives = 34/45 (75.56%), Query Frame = 2
BLAST of CU178214 vs. TrEMBL
Match: A0A0A0LSE2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025940 PE=3 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 1.4e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU178214 vs. TrEMBL
Match: W9QXB5_9ROSA (Putative inositol transporter 2 OS=Morus notabilis GN=L484_005895 PE=3 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.9e-21 Identity = 52/55 (94.55%), Postives = 52/55 (94.55%), Query Frame = 2
BLAST of CU178214 vs. TrEMBL
Match: M5WN45_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa023920mg PE=3 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 2.9e-21 Identity = 52/55 (94.55%), Postives = 52/55 (94.55%), Query Frame = 2
BLAST of CU178214 vs. TrEMBL
Match: W1NV85_AMBTC (Uncharacterized protein OS=Amborella trichopoda GN=AMTR_s00092p00111470 PE=3 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 4.9e-21 Identity = 51/55 (92.73%), Postives = 52/55 (94.55%), Query Frame = 2
BLAST of CU178214 vs. TrEMBL
Match: A0A067KP43_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_04644 PE=3 SV=1) HSP 1 Score: 107.8 bits (268), Expect = 8.3e-21 Identity = 51/55 (92.73%), Postives = 52/55 (94.55%), Query Frame = 2
BLAST of CU178214 vs. NCBI nr
Match: gi|778656600|ref|XP_011649369.1| (PREDICTED: probable inositol transporter 2 [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 2.0e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU178214 vs. NCBI nr
Match: gi|659068462|ref|XP_008444543.1| (PREDICTED: probable inositol transporter 2 [Cucumis melo]) HSP 1 Score: 117.1 bits (292), Expect = 2.0e-23 Identity = 56/56 (100.00%), Postives = 56/56 (100.00%), Query Frame = 2
BLAST of CU178214 vs. NCBI nr
Match: gi|645238086|ref|XP_008225512.1| (PREDICTED: probable inositol transporter 2 [Prunus mume]) HSP 1 Score: 109.0 bits (271), Expect = 5.3e-21 Identity = 52/55 (94.55%), Postives = 52/55 (94.55%), Query Frame = 2
BLAST of CU178214 vs. NCBI nr
Match: gi|595889967|ref|XP_007213472.1| (hypothetical protein PRUPE_ppa023920mg [Prunus persica]) HSP 1 Score: 109.0 bits (271), Expect = 5.3e-21 Identity = 52/55 (94.55%), Postives = 52/55 (94.55%), Query Frame = 2
BLAST of CU178214 vs. NCBI nr
Match: gi|703063612|ref|XP_010087000.1| (putative inositol transporter 2 [Morus notabilis]) HSP 1 Score: 109.0 bits (271), Expect = 5.3e-21 Identity = 52/55 (94.55%), Postives = 52/55 (94.55%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|