CU178056 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTCCATTCGGATTTCTCCCATTGCGCCGTTCTATAGAGTTTCAATCCATTTCCTACTTCTCTTCTCAATAGTGAATACATCCCTTCCATGGCCGACTCTAGCCTGCCTTCTCCAAGAAGAGATTCTATCAAGTCTTCGGTTGGGAGTGTTGCTGCTAATCGAAGACGACAGCATGCGATTGCGGTGGGAAAGGAAAGAAGGGACTTGTTGGTGCGCGCG
BLAST of CU178056 vs. Swiss-Prot
Match: IMPA9_ARATH (Importin subunit alpha-9 OS=Arabidopsis thaliana GN=IMPA9 PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.3e-07 Identity = 29/44 (65.91%), Postives = 31/44 (70.45%), Query Frame = 1
BLAST of CU178056 vs. TrEMBL
Match: A0A0A0KZ40_CUCSA (Importin subunit alpha OS=Cucumis sativus GN=Csa_4G280460 PE=3 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.2e-14 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 1
BLAST of CU178056 vs. TrEMBL
Match: V7BG28_PHAVU (Importin subunit alpha OS=Phaseolus vulgaris GN=PHAVU_007G164500g PE=3 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 5.3e-08 Identity = 32/44 (72.73%), Postives = 38/44 (86.36%), Query Frame = 1
BLAST of CU178056 vs. TrEMBL
Match: D7TQI1_VITVI (Importin subunit alpha OS=Vitis vinifera GN=VIT_08s0040g02290 PE=3 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.2e-07 Identity = 33/43 (76.74%), Postives = 35/43 (81.40%), Query Frame = 1
BLAST of CU178056 vs. TrEMBL
Match: A0A151STB7_CAJCA (Importin subunit alpha OS=Cajanus cajan GN=KK1_004306 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.6e-07 Identity = 31/44 (70.45%), Postives = 37/44 (84.09%), Query Frame = 1
BLAST of CU178056 vs. TrEMBL
Match: K7LHI9_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.6e-07 Identity = 31/44 (70.45%), Postives = 36/44 (81.82%), Query Frame = 1
BLAST of CU178056 vs. NCBI nr
Match: gi|778692950|ref|XP_004142168.2| (PREDICTED: importin subunit alpha-9 isoform X1 [Cucumis sativus]) HSP 1 Score: 82.4 bits (202), Expect = 3.6e-13 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 1
BLAST of CU178056 vs. NCBI nr
Match: gi|659097784|ref|XP_008449812.1| (PREDICTED: importin subunit alpha-2 isoform X1 [Cucumis melo]) HSP 1 Score: 78.6 bits (192), Expect = 5.1e-12 Identity = 41/44 (93.18%), Postives = 43/44 (97.73%), Query Frame = 1
BLAST of CU178056 vs. NCBI nr
Match: gi|720090157|ref|XP_010245001.1| (PREDICTED: importin subunit alpha-2-like [Nelumbo nucifera]) HSP 1 Score: 63.5 bits (153), Expect = 1.7e-07 Identity = 34/44 (77.27%), Postives = 38/44 (86.36%), Query Frame = 1
BLAST of CU178056 vs. NCBI nr
Match: gi|593687763|ref|XP_007144541.1| (hypothetical protein PHAVU_007G164500g [Phaseolus vulgaris]) HSP 1 Score: 61.2 bits (147), Expect = 8.5e-07 Identity = 32/44 (72.73%), Postives = 38/44 (86.36%), Query Frame = 1
BLAST of CU178056 vs. NCBI nr
Match: gi|1009168551|ref|XP_015902720.1| (PREDICTED: importin subunit alpha-9 [Ziziphus jujuba]) HSP 1 Score: 60.5 bits (145), Expect = 1.4e-06 Identity = 32/44 (72.73%), Postives = 37/44 (84.09%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|