CU177991 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
NGGTAGCAGGGTTCAAAACTGGCAATGGCTGAAGTATGGAGTGGAATTGGATGGAGATGGGCTTGGTGTGAGAGTGAACAAGGAACTGTTTGGGAGAGTGGTGGAAGAAGAAATGGAAAGGATTGAAAGAGAAGTTGGGAAAGAGAGATTCAAAAAAGGAATGTACAAAGAAGCTTGCAAGATGTTCACAAGGCAATGCACAGCTCCAAATTTGGATGACTTTCTGACCTTAGACGCTTACAACTATATTGTTATACATCATCCAAGGGAATTGTCCAAGCTTTGAAAAGTGAAAACCACCACCAAAACACTTGCTTTTGCTTCCATTCTCTTCTTGTTACTGAGAATAACGTATCTGTAATGTAAGTCTGTCTTTGTCCATTTCTTTTTGCAAGCTGTGTGGTTATTTCAAGAAATCCAGCAATTGCAAGCAAATTGGAATTCGGTACTTCTCTATATATAAACCTATATTTTGCCTGTT
BLAST of CU177991 vs. Swiss-Prot
Match: MASY_CUCSA (Malate synthase, glyoxysomal OS=Cucumis sativus PE=2 SV=2) HSP 1 Score: 162.2 bits (409), Expect = 4.8e-39 Identity = 77/91 (84.62%), Postives = 75/91 (82.42%), Query Frame = 2
BLAST of CU177991 vs. Swiss-Prot
Match: MASY_CUCMA (Malate synthase, glyoxysomal OS=Cucurbita maxima PE=1 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 2.3e-36 Identity = 72/91 (79.12%), Postives = 73/91 (80.22%), Query Frame = 2
BLAST of CU177991 vs. Swiss-Prot
Match: MASY_SOYBN (Malate synthase, glyoxysomal (Fragment) OS=Glycine max PE=2 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 3.6e-34 Identity = 67/91 (73.63%), Postives = 72/91 (79.12%), Query Frame = 2
BLAST of CU177991 vs. Swiss-Prot
Match: MASY_GOSHI (Malate synthase, glyoxysomal OS=Gossypium hirsutum PE=2 SV=1) HSP 1 Score: 137.5 bits (345), Expect = 1.3e-31 Identity = 66/91 (72.53%), Postives = 70/91 (76.92%), Query Frame = 2
BLAST of CU177991 vs. Swiss-Prot
Match: MASY_ARATH (Malate synthase OS=Arabidopsis thaliana GN=MLS PE=1 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 1.8e-30 Identity = 61/91 (67.03%), Postives = 68/91 (74.73%), Query Frame = 2
BLAST of CU177991 vs. TrEMBL
Match: A0A0A0LUC5_CUCSA (Malate synthase OS=Cucumis sativus GN=Csa_1G050360 PE=3 SV=1) HSP 1 Score: 162.2 bits (409), Expect = 5.4e-37 Identity = 77/91 (84.62%), Postives = 77/91 (84.62%), Query Frame = 2
BLAST of CU177991 vs. TrEMBL
Match: E3UZU8_CUCMA (Malate synthase OS=Cucurbita maxima PE=2 SV=1) HSP 1 Score: 153.3 bits (386), Expect = 2.5e-34 Identity = 72/91 (79.12%), Postives = 75/91 (82.42%), Query Frame = 2
BLAST of CU177991 vs. TrEMBL
Match: A0A0B2Q284_GLYSO (Malate synthase OS=Glycine soja GN=glysoja_033315 PE=3 SV=1) HSP 1 Score: 148.3 bits (373), Expect = 8.1e-33 Identity = 68/91 (74.73%), Postives = 74/91 (81.32%), Query Frame = 2
BLAST of CU177991 vs. TrEMBL
Match: I1MUM7_SOYBN (Malate synthase OS=Glycine max GN=GLYMA_17G128000 PE=3 SV=1) HSP 1 Score: 147.5 bits (371), Expect = 1.4e-32 Identity = 68/91 (74.73%), Postives = 74/91 (81.32%), Query Frame = 2
BLAST of CU177991 vs. TrEMBL
Match: G7ZYR8_MEDTR (Malate synthase OS=Medicago truncatula GN=MTR_8g028225 PE=3 SV=1) HSP 1 Score: 142.9 bits (359), Expect = 3.4e-31 Identity = 66/91 (72.53%), Postives = 74/91 (81.32%), Query Frame = 2
BLAST of CU177991 vs. NCBI nr
Match: gi|167521|gb|AAA33123.1| (glyoxysomal malate synthase (EC 4.1.3.1), partial [Cucumis sativus]) HSP 1 Score: 166.4 bits (420), Expect = 4.1e-38 Identity = 78/92 (84.78%), Postives = 78/92 (84.78%), Query Frame = 2
BLAST of CU177991 vs. NCBI nr
Match: gi|126768|sp|P08216.2|MASY_CUCSA (RecName: Full=Malate synthase, glyoxysomal [Cucumis sativus]) HSP 1 Score: 164.5 bits (415), Expect = 1.6e-37 Identity = 77/91 (84.62%), Postives = 77/91 (84.62%), Query Frame = 2
BLAST of CU177991 vs. NCBI nr
Match: gi|659067451|ref|XP_008439505.1| (PREDICTED: malate synthase, glyoxysomal [Cucumis melo]) HSP 1 Score: 164.5 bits (415), Expect = 1.6e-37 Identity = 77/91 (84.62%), Postives = 77/91 (84.62%), Query Frame = 2
BLAST of CU177991 vs. NCBI nr
Match: gi|449469625|ref|XP_004152519.1| (PREDICTED: malate synthase, glyoxysomal [Cucumis sativus]) HSP 1 Score: 164.5 bits (415), Expect = 1.6e-37 Identity = 77/91 (84.62%), Postives = 77/91 (84.62%), Query Frame = 2
BLAST of CU177991 vs. NCBI nr
Match: gi|310697396|gb|ADP06653.1| (malate synthase [Cucurbita maxima]) HSP 1 Score: 155.6 bits (392), Expect = 7.2e-35 Identity = 72/91 (79.12%), Postives = 75/91 (82.42%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|