CU177540 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTAACTCTGTGGCACTTTGCTGTTTCTTTGTTGTCCTTTTAGTAAGCAAATTTCTTCAAGTGCCATATTCTGTGGCTTCCCACATGGTCCCAAAGGACTTGGACGATCTCGAATCTTACGGTCTCTACTAACCGGCGACCTACCCTTTCGAGGAGAAGAAAGGAATG
BLAST of CU177540 vs. TrEMBL
Match: A0A0A0KWF9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G000960 PE=4 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 8.4e-14 Identity = 41/49 (83.67%), Postives = 43/49 (87.76%), Query Frame = -3
BLAST of CU177540 vs. TrEMBL
Match: B9GI77_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0001s30350g PE=4 SV=2) HSP 1 Score: 70.9 bits (172), Expect = 5.6e-10 Identity = 33/39 (84.62%), Postives = 35/39 (89.74%), Query Frame = -3
BLAST of CU177540 vs. TrEMBL
Match: B9HMX5_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0009s09370g PE=4 SV=2) HSP 1 Score: 70.1 bits (170), Expect = 9.6e-10 Identity = 32/39 (82.05%), Postives = 35/39 (89.74%), Query Frame = -3
BLAST of CU177540 vs. TrEMBL
Match: B9SNC4_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0174780 PE=4 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 1.1e-08 Identity = 30/39 (76.92%), Postives = 33/39 (84.62%), Query Frame = -3
BLAST of CU177540 vs. TrEMBL
Match: M5W4S4_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa007726mg PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 1.8e-08 Identity = 30/38 (78.95%), Postives = 33/38 (86.84%), Query Frame = -3
BLAST of CU177540 vs. NCBI nr
Match: gi|659108776|ref|XP_008454383.1| (PREDICTED: uncharacterized protein LOC103494799 [Cucumis melo]) HSP 1 Score: 82.8 bits (203), Expect = 2.1e-13 Identity = 41/49 (83.67%), Postives = 43/49 (87.76%), Query Frame = -3
BLAST of CU177540 vs. NCBI nr
Match: gi|700197619|gb|KGN52777.1| (hypothetical protein Csa_4G000960 [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 2.1e-13 Identity = 41/49 (83.67%), Postives = 43/49 (87.76%), Query Frame = -3
BLAST of CU177540 vs. NCBI nr
Match: gi|449469122|ref|XP_004152270.1| (PREDICTED: uncharacterized protein LOC101211126 [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 2.1e-13 Identity = 41/49 (83.67%), Postives = 43/49 (87.76%), Query Frame = -3
BLAST of CU177540 vs. NCBI nr
Match: gi|743858109|ref|XP_011030363.1| (PREDICTED: uncharacterized protein LOC105129827 [Populus euphratica]) HSP 1 Score: 70.1 bits (170), Expect = 1.4e-09 Identity = 33/39 (84.62%), Postives = 35/39 (89.74%), Query Frame = -3
BLAST of CU177540 vs. NCBI nr
Match: gi|566151827|ref|XP_002300258.2| (hypothetical protein POPTR_0001s30350g [Populus trichocarpa]) HSP 1 Score: 70.1 bits (170), Expect = 1.4e-09 Identity = 33/39 (84.62%), Postives = 35/39 (89.74%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|