CU176375 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGTTCACCCTACTGCAGTGGCGACAACAACCTTCTCCTCCTTACGAGCGTCGGAAGGTGCCTTTTCTTCTTCCTCTCGATGGTTTGGGGCATCAACGGCCGTCCCTTCCCCACAGAGCAAAAACCTAGGAAACCATCC
BLAST of CU176375 vs. TrEMBL
Match: A0A0A0L996_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G204780 PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 3.0e-17 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -1
BLAST of CU176375 vs. NCBI nr
Match: gi|700202391|gb|KGN57524.1| (hypothetical protein Csa_3G204780 [Cucumis sativus]) HSP 1 Score: 94.7 bits (234), Expect = 4.4e-17 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|