CU176038 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGGGGAACGAAGGCCTTTGCGGGGCGCCACTCAGCATTACGTGTAAGAATTCAATTGGTCCATACAATCAAGTATTTACCTATCACAAGGTCTCATACAAGATCATACTGGCTGTCATCGGTTCCGGTCTGG
BLAST of CU176038 vs. TrEMBL
Match: A0A0A0KWB9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G166920 PE=4 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 2.5e-13 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 1
BLAST of CU176038 vs. TrEMBL
Match: B9SUE1_RICCO (ATP binding protein, putative OS=Ricinus communis GN=RCOM_0750120 PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 7.9e-07 Identity = 29/44 (65.91%), Postives = 36/44 (81.82%), Query Frame = 1
BLAST of CU176038 vs. TrEMBL
Match: A0A0D2RJJ3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G092400 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 5.1e-06 Identity = 28/43 (65.12%), Postives = 34/43 (79.07%), Query Frame = 1
BLAST of CU176038 vs. TrEMBL
Match: A0A0B0MEW6_GOSAR (Uncharacterized protein OS=Gossypium arboreum GN=F383_36821 PE=4 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 8.8e-06 Identity = 27/43 (62.79%), Postives = 35/43 (81.40%), Query Frame = 1
BLAST of CU176038 vs. TrEMBL
Match: A0A068VG20_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00004122001 PE=4 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 8.8e-06 Identity = 30/43 (69.77%), Postives = 34/43 (79.07%), Query Frame = 1
BLAST of CU176038 vs. NCBI nr
Match: gi|449463364|ref|XP_004149404.1| (PREDICTED: leucine-rich repeat receptor-like tyrosine-protein kinase At2g41820 [Cucumis sativus]) HSP 1 Score: 82.4 bits (202), Expect = 2.1e-13 Identity = 40/44 (90.91%), Postives = 42/44 (95.45%), Query Frame = 1
BLAST of CU176038 vs. NCBI nr
Match: gi|659121669|ref|XP_008460767.1| (PREDICTED: leucine-rich repeat receptor-like tyrosine-protein kinase At2g41820 [Cucumis melo]) HSP 1 Score: 81.3 bits (199), Expect = 4.8e-13 Identity = 39/44 (88.64%), Postives = 42/44 (95.45%), Query Frame = 1
BLAST of CU176038 vs. NCBI nr
Match: gi|223530895|gb|EEF32755.1| (ATP binding protein, putative [Ricinus communis]) HSP 1 Score: 60.8 bits (146), Expect = 6.7e-07 Identity = 29/44 (65.91%), Postives = 36/44 (81.82%), Query Frame = 1
BLAST of CU176038 vs. NCBI nr
Match: gi|1000945845|ref|XP_015581146.1| (PREDICTED: LOW QUALITY PROTEIN: leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 [Ricinus communis]) HSP 1 Score: 60.8 bits (146), Expect = 6.7e-07 Identity = 29/44 (65.91%), Postives = 36/44 (81.82%), Query Frame = 1
BLAST of CU176038 vs. NCBI nr
Match: gi|1009161646|ref|XP_015899010.1| (PREDICTED: leucine-rich repeat receptor-like tyrosine-protein kinase PXC3 [Ziziphus jujuba]) HSP 1 Score: 58.9 bits (141), Expect = 2.5e-06 Identity = 28/44 (63.64%), Postives = 36/44 (81.82%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|