CU175995 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU175995
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr4 : 6344801 .. 6344870 (-)
Sequence length	70

The following sequences are available for this feature:

GAGGGTGCTAAGAGGTGTCAACCTAGTTGAGATCTCCGGGTGCACCTTCTGATCTTTTGGTTCCTTTGCT


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa4G097120	Csa4G097120	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0179455	H0179455	EST