CU175884 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGAGTTTTGCTAGGGTTGAGACTCTTGTTACCATACATTACTTGATCACCCAATTCACATGGAAACTACTTTTGGATGACCATTTTATCAGAGATCCAATGCCAACACCTACCAAAG
BLAST of CU175884 vs. TrEMBL
Match: A0A0A0LA02_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G186690 PE=3 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 2.3e-13 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of CU175884 vs. TrEMBL
Match: A0A059BN22_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_F00881 PE=3 SV=1) HSP 1 Score: 66.6 bits (161), Expect = 7.5e-09 Identity = 26/37 (70.27%), Postives = 33/37 (89.19%), Query Frame = 1
BLAST of CU175884 vs. TrEMBL
Match: B9SAF0_RICCO (Cytochrome P450, putative OS=Ricinus communis GN=RCOM_0585670 PE=3 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 9.8e-09 Identity = 29/37 (78.38%), Postives = 32/37 (86.49%), Query Frame = 1
BLAST of CU175884 vs. TrEMBL
Match: A0A067KSB1_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_00863 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 1.7e-08 Identity = 28/37 (75.68%), Postives = 32/37 (86.49%), Query Frame = 1
BLAST of CU175884 vs. TrEMBL
Match: U5FX14_POPTR (Uncharacterized protein (Fragment) OS=Populus trichocarpa GN=POPTR_0011s14090g PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 2.2e-08 Identity = 27/37 (72.97%), Postives = 33/37 (89.19%), Query Frame = 1
BLAST of CU175884 vs. NCBI nr
Match: gi|449446129|ref|XP_004140824.1| (PREDICTED: cytochrome P450 716B1-like [Cucumis sativus]) HSP 1 Score: 80.9 bits (198), Expect = 5.5e-13 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 1
BLAST of CU175884 vs. NCBI nr
Match: gi|659114553|ref|XP_008457111.1| (PREDICTED: cytochrome P450 716B1-like [Cucumis melo]) HSP 1 Score: 77.8 bits (190), Expect = 4.7e-12 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 1
BLAST of CU175884 vs. NCBI nr
Match: gi|629101631|gb|KCW67100.1| (hypothetical protein EUGRSUZ_F00881 [Eucalyptus grandis]) HSP 1 Score: 65.9 bits (159), Expect = 1.8e-08 Identity = 26/37 (70.27%), Postives = 33/37 (89.19%), Query Frame = 1
BLAST of CU175884 vs. NCBI nr
Match: gi|255563939|ref|XP_002522969.1| (PREDICTED: cytochrome P450 716B1 [Ricinus communis]) HSP 1 Score: 65.5 bits (158), Expect = 2.4e-08 Identity = 29/37 (78.38%), Postives = 32/37 (86.49%), Query Frame = 1
BLAST of CU175884 vs. NCBI nr
Match: gi|643731914|gb|KDP39106.1| (hypothetical protein JCGZ_00863 [Jatropha curcas]) HSP 1 Score: 64.7 bits (156), Expect = 4.1e-08 Identity = 28/37 (75.68%), Postives = 32/37 (86.49%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|