CU175875 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGGTAAGAAGATAGAACTAAAGCCAGGCTTTTCTGTATTGGAGCACGATGAGGATGTGGGGAGCTGTTGTGGTTGGATTTTGATCGATACTTTAACTACTACAAAGTGCAGTATGGAACACTCTGCATAAGAGAAAATCCTGGTTGCCTCTTCATTGCAACTAATCGTGATGCTGTCACTCATCTGACAGATGCGACAAGGAGGTGGGGCAGGGTTGGTGGTTACAAGTTGGGTTGG
BLAST of CU175875 vs. Swiss-Prot
Match: PGP1A_ARATH (Phosphoglycolate phosphatase 1A, chloroplastic OS=Arabidopsis thaliana GN=PGLP1A PE=1 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 3.4e-17 Identity = 42/52 (80.77%), Postives = 43/52 (82.69%), Query Frame = 1
BLAST of CU175875 vs. Swiss-Prot
Match: PGP1B_ARATH (Phosphoglycolate phosphatase 1B, chloroplastic OS=Arabidopsis thaliana GN=PGLP1B PE=1 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 3.4e-17 Identity = 42/52 (80.77%), Postives = 43/52 (82.69%), Query Frame = 1
BLAST of CU175875 vs. Swiss-Prot
Match: PGP2_ARATH (Phosphoglycolate phosphatase 2 OS=Arabidopsis thaliana GN=PGLP2 PE=1 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 5.6e-12 Identity = 32/46 (69.57%), Postives = 34/46 (73.91%), Query Frame = 1
BLAST of CU175875 vs. TrEMBL
Match: A0A0D2QQG9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G088000 PE=4 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 5.8e-16 Identity = 42/53 (79.25%), Postives = 44/53 (83.02%), Query Frame = 1
BLAST of CU175875 vs. TrEMBL
Match: A0A0D2QQG9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_003G088000 PE=4 SV=1) HSP 1 Score: 35.8 bits (81), Expect = 2.8e+01 Identity = 16/21 (76.19%), Postives = 20/21 (95.24%), Query Frame = 2
HSP 2 Score: 89.0 bits (219), Expect = 2.9e-15 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of CU175875 vs. TrEMBL
Match: I3T999_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.9e-15 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of CU175875 vs. TrEMBL
Match: I3T999_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 9.8e+00 Identity = 17/21 (80.95%), Postives = 20/21 (95.24%), Query Frame = 2
HSP 2 Score: 89.0 bits (219), Expect = 2.9e-15 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of CU175875 vs. TrEMBL
Match: A0A0D9W6K5_9ORYZ (Uncharacterized protein OS=Leersia perrieri PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.9e-15 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of CU175875 vs. NCBI nr
Match: gi|743781963|ref|XP_011007944.1| (PREDICTED: phosphoglycolate phosphatase 1B, chloroplastic-like [Populus euphratica]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 44/52 (84.62%), Postives = 46/52 (88.46%), Query Frame = 1
BLAST of CU175875 vs. NCBI nr
Match: gi|763751803|gb|KJB19191.1| (hypothetical protein B456_003G088000 [Gossypium raimondii]) HSP 1 Score: 93.2 bits (230), Expect = 2.2e-16 Identity = 42/53 (79.25%), Postives = 44/53 (83.02%), Query Frame = 1
BLAST of CU175875 vs. NCBI nr
Match: gi|629120118|gb|KCW84608.1| (hypothetical protein EUGRSUZ_B01439 [Eucalyptus grandis]) HSP 1 Score: 91.3 bits (225), Expect = 8.3e-16 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of CU175875 vs. NCBI nr
Match: gi|475589243|gb|EMT21102.1| (Phosphoglycolate phosphatase [Aegilops tauschii]) HSP 1 Score: 91.3 bits (225), Expect = 8.3e-16 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
BLAST of CU175875 vs. NCBI nr
Match: gi|672168349|ref|XP_008804176.1| (PREDICTED: phosphoglycolate phosphatase 1B, chloroplastic-like [Phoenix dactylifera]) HSP 1 Score: 91.3 bits (225), Expect = 8.3e-16 Identity = 43/52 (82.69%), Postives = 45/52 (86.54%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|