CU175306 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU175306
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr3 : 13455807 .. 13455886 (+)
Sequence length	85

The following sequences are available for this feature:

GGAATCCTTCCATTTCTTTCTACTATTCTTTCCCCAGCTCTTCAGTCTCCAGTAGCAACCATAGATGGCTGAGAACCCGATCCGA


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa3G194390	Csa3G194390	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0174788	H0174788	EST