CU174884 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGTTATTGCTTCAAGATTTACATAGTACTGAAATATTTCGTAACAGCAATGGACCCAGAATCGTTATGGACATTCTAAATAGTGGAAAGCAAAATGTAAATATCTTATATGGTGGCTTTGCTGTTTGTTGCTGCGGCTGCGACTGCTAATGAGGTTGTTAAAGAAGTATTCATGGAGATGAATATTGATGAGCTTTATTTTGCAAACTCTGAGTACGTATAGGGGAGACTGCATCAATAGCTT
BLAST of CU174884 vs. TrEMBL
Match: A0A0A0K4T9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G074820 PE=4 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 5.5e-14 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU174884 vs. TrEMBL
Match: A0A0A0K4T9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G074820 PE=4 SV=1) HSP 1 Score: 34.7 bits (78), Expect = 6.5e+01 Identity = 15/15 (100.00%), Postives = 15/15 (100.00%), Query Frame = 2
BLAST of CU174884 vs. NCBI nr
Match: gi|449438432|ref|XP_004136992.1| (PREDICTED: armadillo repeat-containing protein 6 [Cucumis sativus]) HSP 1 Score: 85.5 bits (210), Expect = 4.6e-14 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU174884 vs. NCBI nr
Match: gi|659109856|ref|XP_008454917.1| (PREDICTED: armadillo repeat-containing protein 6 [Cucumis melo]) HSP 1 Score: 84.3 bits (207), Expect = 1.0e-13 Identity = 40/41 (97.56%), Postives = 41/41 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|