CU174707 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAACACAATCCAATCAAACTCCAAAAAAAAGATATATTATTGTCTATCTCCATCTCTTTTCCCCTTTGTCTCTCCCTCATTGAAAACTTTTATCATATGGCCAAGTCTAAAACCATGAAGAAAAAGAATTGTATCAAGGTGGTCGTAGAGAAGTTGCAAAAGAGCCTCTCGCGAGGTCGAAAACCGATTAA
BLAST of CU174707 vs. TrEMBL
Match: A0A0A0LSM9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G103250 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.9e-06 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|