CU174677 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATTCAAGTCATCGCCTTCGTCGATCAGTGGAAGGGGAAGGCGGCGAACGATAGAACAAATCAGCCCCATGAATCGACCATAGCTACATTTTTAGCCACATCGAGGCGACCAAGAAAGATAATCTCTGCTACGACGACGAGAGCGATGAACAGAGGCATCGCATTTGACCATTTTTTCTTGGGAGGCATCGGAGTCCCAATGGACACCGGCAACTCCTCGGCGGTGGCCCATGATCGG
BLAST of CU174677 vs. TrEMBL
Match: A0A0A0L6G6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G206320 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 5.8e-24 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = -2
BLAST of CU174677 vs. TrEMBL
Match: M5VLW9_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa004581mg PE=3 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.7e-12 Identity = 37/57 (64.91%), Postives = 44/57 (77.19%), Query Frame = -2
BLAST of CU174677 vs. TrEMBL
Match: A0A059AN64_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_I01147 PE=3 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 33/49 (67.35%), Postives = 40/49 (81.63%), Query Frame = -2
BLAST of CU174677 vs. TrEMBL
Match: A0A059AP59_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_I01147 PE=3 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 33/49 (67.35%), Postives = 40/49 (81.63%), Query Frame = -2
BLAST of CU174677 vs. TrEMBL
Match: W9S687_9ROSA (Glycoprotein 3-alpha-L-fucosyltransferase A OS=Morus notabilis GN=L484_027524 PE=3 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.6e-10 Identity = 41/76 (53.95%), Postives = 48/76 (63.16%), Query Frame = -2
BLAST of CU174677 vs. NCBI nr
Match: gi|449446089|ref|XP_004140804.1| (PREDICTED: glycoprotein 3-alpha-L-fucosyltransferase A [Cucumis sativus]) HSP 1 Score: 117.5 bits (293), Expect = 1.1e-23 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = -2
BLAST of CU174677 vs. NCBI nr
Match: gi|700202397|gb|KGN57530.1| (hypothetical protein Csa_3G206320 [Cucumis sativus]) HSP 1 Score: 117.5 bits (293), Expect = 1.1e-23 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = -2
BLAST of CU174677 vs. NCBI nr
Match: gi|659112246|ref|XP_008456133.1| (PREDICTED: glycoprotein 3-alpha-L-fucosyltransferase A-like [Cucumis melo]) HSP 1 Score: 110.2 bits (274), Expect = 1.7e-21 Identity = 54/57 (94.74%), Postives = 54/57 (94.74%), Query Frame = -2
BLAST of CU174677 vs. NCBI nr
Match: gi|645262045|ref|XP_008236585.1| (PREDICTED: glycoprotein 3-alpha-L-fucosyltransferase A-like [Prunus mume]) HSP 1 Score: 79.3 bits (194), Expect = 3.3e-12 Identity = 37/57 (64.91%), Postives = 44/57 (77.19%), Query Frame = -2
BLAST of CU174677 vs. NCBI nr
Match: gi|595795174|ref|XP_007200973.1| (hypothetical protein PRUPE_ppa004581mg [Prunus persica]) HSP 1 Score: 79.3 bits (194), Expect = 3.3e-12 Identity = 37/57 (64.91%), Postives = 44/57 (77.19%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|