CU173454 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAAACCAATATTAATTATTCTCTGTCGCTCTTCTTTCTCTTAAAATAAAATGAGTGTGGCTTTTCTTAATGATACAACAGTTACAAACTTCATCAATGACACCAAGATATTTGACGATTGTGTCAAGGAAAGTTTTAAGAAACTCGACACGGACAATGATGGGTTTCTCAACATGAATGAAC
BLAST of CU173454 vs. TrEMBL
Match: A0A0A0LYD8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G695380 PE=4 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 6.8e-17 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 3
BLAST of CU173454 vs. NCBI nr
Match: gi|449449633|ref|XP_004142569.1| (PREDICTED: uncharacterized protein LOC101222885 [Cucumis sativus]) HSP 1 Score: 91.7 bits (226), Expect = 4.8e-16 Identity = 44/44 (100.00%), Postives = 44/44 (100.00%), Query Frame = 3
BLAST of CU173454 vs. NCBI nr
Match: gi|659125605|ref|XP_008462771.1| (PREDICTED: uncharacterized protein LOC103501058 [Cucumis melo]) HSP 1 Score: 87.0 bits (214), Expect = 1.2e-14 Identity = 42/44 (95.45%), Postives = 42/44 (95.45%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|