CU173328 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGGGTGGCCAGGAACTATCAGCTGCAGCTGATGGGGTTTCCCCTCCCCAAGCTTCTTAGCGACGTGACTCAGACGATCGAGCAGGCTGGTCTTGCCAATTCTGTTGTCATCCAGAAGTTTTAGCAACTTGGGTTAAGTTTTCTTTAAGACCATAACTAAAGAGGAAGAAAGAAAAACATTACAAA
BLAST of CU173328 vs. Swiss-Prot
Match: PUX4_ARATH (Plant UBX domain-containing protein 4 OS=Arabidopsis thaliana GN=PUX4 PE=1 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 9.9e-09 Identity = 30/40 (75.00%), Postives = 33/40 (82.50%), Query Frame = 3
BLAST of CU173328 vs. Swiss-Prot
Match: PUX3_ARATH (Plant UBX domain-containing protein 3 OS=Arabidopsis thaliana GN=PUX3 PE=1 SV=1) HSP 1 Score: 54.7 bits (130), Expect = 4.2e-07 Identity = 29/40 (72.50%), Postives = 31/40 (77.50%), Query Frame = 3
BLAST of CU173328 vs. Swiss-Prot
Match: PUX5_ARATH (Plant UBX domain-containing protein 5 OS=Arabidopsis thaliana GN=PUX5 PE=1 SV=1) HSP 1 Score: 52.0 bits (123), Expect = 2.7e-06 Identity = 26/40 (65.00%), Postives = 31/40 (77.50%), Query Frame = 3
BLAST of CU173328 vs. TrEMBL
Match: A0A0A0M3Q0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G701220 PE=4 SV=1) HSP 1 Score: 71.6 bits (174), Expect = 3.7e-10 Identity = 38/40 (95.00%), Postives = 38/40 (95.00%), Query Frame = 3
BLAST of CU173328 vs. TrEMBL
Match: I3SVF6_LOTJA (Uncharacterized protein OS=Lotus japonicus PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 6.9e-09 Identity = 35/38 (92.11%), Postives = 36/38 (94.74%), Query Frame = 3
BLAST of CU173328 vs. TrEMBL
Match: A0A067GSF5_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g022009mg PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 9.0e-09 Identity = 34/40 (85.00%), Postives = 37/40 (92.50%), Query Frame = 3
BLAST of CU173328 vs. TrEMBL
Match: A0A067GSR0_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g022009mg PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 9.0e-09 Identity = 34/40 (85.00%), Postives = 37/40 (92.50%), Query Frame = 3
BLAST of CU173328 vs. TrEMBL
Match: V4UFS7_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10016067mg PE=4 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 9.0e-09 Identity = 34/40 (85.00%), Postives = 37/40 (92.50%), Query Frame = 3
BLAST of CU173328 vs. NCBI nr
Match: gi|449455377|ref|XP_004145429.1| (PREDICTED: UBA and UBX domain-containing protein At4g15410-like [Cucumis sativus]) HSP 1 Score: 73.9 bits (180), Expect = 1.1e-10 Identity = 38/40 (95.00%), Postives = 38/40 (95.00%), Query Frame = 3
BLAST of CU173328 vs. NCBI nr
Match: gi|659118191|ref|XP_008458991.1| (PREDICTED: UBA and UBX domain-containing protein At4g15410-like [Cucumis melo]) HSP 1 Score: 73.9 bits (180), Expect = 1.1e-10 Identity = 38/40 (95.00%), Postives = 38/40 (95.00%), Query Frame = 3
BLAST of CU173328 vs. NCBI nr
Match: gi|388512373|gb|AFK44248.1| (unknown [Lotus japonicus]) HSP 1 Score: 69.7 bits (169), Expect = 2.0e-09 Identity = 35/38 (92.11%), Postives = 36/38 (94.74%), Query Frame = 3
BLAST of CU173328 vs. NCBI nr
Match: gi|641859682|gb|KDO78372.1| (hypothetical protein CISIN_1g022009mg [Citrus sinensis]) HSP 1 Score: 69.3 bits (168), Expect = 2.6e-09 Identity = 34/40 (85.00%), Postives = 37/40 (92.50%), Query Frame = 3
BLAST of CU173328 vs. NCBI nr
Match: gi|568826018|ref|XP_006467372.1| (PREDICTED: plant UBX domain-containing protein 4 [Citrus sinensis]) HSP 1 Score: 69.3 bits (168), Expect = 2.6e-09 Identity = 34/40 (85.00%), Postives = 37/40 (92.50%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|