CU173229 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGCGGCTGACGGAATCTCTCGCCGGCAAATGTACTTGCGGAGTTACACCTTCTCTAGAGAGGACATCGTTGTCCCTGGGACTACAACTCAGAATTGCTTTGGGAAGATCAGGCGGCGGCGCCGGAAGCCAGCGACGATTCGCGGCGGTCGTAGGAGGAGCCGATGTTTGGCCATGGTGAAGGCCGCCGCCAGTCAGGTTTTCTTCCGGGCGCCTTGCTCTT
BLAST of CU173229 vs. TrEMBL
Match: A0A0A0LXY3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G497810 PE=4 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 2.9e-14 Identity = 46/66 (69.70%), Postives = 46/66 (69.70%), Query Frame = 2
BLAST of CU173229 vs. NCBI nr
Match: gi|778665185|ref|XP_011648508.1| (PREDICTED: uncharacterized protein LOC105434501 [Cucumis sativus]) HSP 1 Score: 86.3 bits (212), Expect = 2.5e-14 Identity = 46/66 (69.70%), Postives = 46/66 (69.70%), Query Frame = 2
BLAST of CU173229 vs. NCBI nr
Match: gi|659115478|ref|XP_008457578.1| (PREDICTED: uncharacterized protein LOC103497245 [Cucumis melo]) HSP 1 Score: 78.6 bits (192), Expect = 5.1e-12 Identity = 41/65 (63.08%), Postives = 43/65 (66.15%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|