CU173186 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGAAAAAGAAGTAGAAGGATTTAGGGAAAGTACTCCGGTTTCTCTTCAGAACTAGAGGATTGGGTTCCTTCGGAATCTCTATCCCCAGTCGCTTCTTCCAATTGCTGGCGTTGCTTTTCTTCCTCACCTTCATCTACTCGTTGTCCTTCCTTCAACTGTTCC
BLAST of CU173186 vs. TrEMBL
Match: A0A0A0KB89_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G155540 PE=4 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 2.6e-15 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU173186 vs. NCBI nr
Match: gi|778713644|ref|XP_011657078.1| (PREDICTED: putative E3 ubiquitin-protein ligase RING1a isoform X2 [Cucumis sativus]) HSP 1 Score: 77.0 bits (188), Expect = 1.1e-11 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU173186 vs. NCBI nr
Match: gi|449463098|ref|XP_004149271.1| (PREDICTED: putative E3 ubiquitin-protein ligase RING1a isoform X4 [Cucumis sativus]) HSP 1 Score: 77.0 bits (188), Expect = 1.1e-11 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU173186 vs. NCBI nr
Match: gi|778713642|ref|XP_011657077.1| (PREDICTED: putative E3 ubiquitin-protein ligase RING1a isoform X1 [Cucumis sativus]) HSP 1 Score: 77.0 bits (188), Expect = 1.1e-11 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU173186 vs. NCBI nr
Match: gi|778713646|ref|XP_011657079.1| (PREDICTED: putative E3 ubiquitin-protein ligase RING1a isoform X3 [Cucumis sativus]) HSP 1 Score: 77.0 bits (188), Expect = 1.1e-11 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU173186 vs. NCBI nr
Match: gi|778713653|ref|XP_011657082.1| (PREDICTED: putative E3 ubiquitin-protein ligase RING1a isoform X7 [Cucumis sativus]) HSP 1 Score: 75.5 bits (184), Expect = 3.2e-11 Identity = 43/43 (100.00%), Postives = 43/43 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|