CU172802 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGGAGCCCAAATGAAATCCAATTTCATCCCAGTTTCACCAATCAGAATTTGGTAATTACTATGCCGTTTGAACAGATCGCCTCTAACAGCTTCCATTCTTTGAGAATCCAACGTCAAATCCAGCAGTGACAGAGCCATCAATCTCGCCTGTGAGTCACCGGCGACAACAACCCATGACCCATTAAGCAAATCAGCAACATCCGTGGGA
BLAST of CU172802 vs. TrEMBL
Match: A0A0A0L9Z7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G307680 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 3.7e-19 Identity = 51/69 (73.91%), Postives = 51/69 (73.91%), Query Frame = -2
BLAST of CU172802 vs. TrEMBL
Match: K4B9Z3_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 82.0 bits (201), Expect = 3.1e-13 Identity = 40/68 (58.82%), Postives = 44/68 (64.71%), Query Frame = -2
BLAST of CU172802 vs. TrEMBL
Match: V4SSH8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10012019mg PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 8.9e-13 Identity = 38/68 (55.88%), Postives = 46/68 (67.65%), Query Frame = -2
BLAST of CU172802 vs. TrEMBL
Match: A0A067ETW3_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g017787mg PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 8.9e-13 Identity = 38/68 (55.88%), Postives = 46/68 (67.65%), Query Frame = -2
BLAST of CU172802 vs. TrEMBL
Match: A0A022QU97_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a008751mg PE=4 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.2e-12 Identity = 39/68 (57.35%), Postives = 43/68 (63.24%), Query Frame = -2
BLAST of CU172802 vs. NCBI nr
Match: gi|449456210|ref|XP_004145843.1| (PREDICTED: uncharacterized protein LOC101220526 [Cucumis sativus]) HSP 1 Score: 104.4 bits (259), Expect = 8.3e-20 Identity = 51/69 (73.91%), Postives = 51/69 (73.91%), Query Frame = -2
BLAST of CU172802 vs. NCBI nr
Match: gi|659114395|ref|XP_008457033.1| (PREDICTED: uncharacterized protein LOC103496810 [Cucumis melo]) HSP 1 Score: 101.7 bits (252), Expect = 5.4e-19 Identity = 49/69 (71.01%), Postives = 50/69 (72.46%), Query Frame = -2
BLAST of CU172802 vs. NCBI nr
Match: gi|297738148|emb|CBI27349.3| (unnamed protein product [Vitis vinifera]) HSP 1 Score: 85.5 bits (210), Expect = 4.0e-14 Identity = 39/68 (57.35%), Postives = 47/68 (69.12%), Query Frame = -2
BLAST of CU172802 vs. NCBI nr
Match: gi|225466247|ref|XP_002270106.1| (PREDICTED: uncharacterized protein LOC100244457 [Vitis vinifera]) HSP 1 Score: 85.5 bits (210), Expect = 4.0e-14 Identity = 39/68 (57.35%), Postives = 47/68 (69.12%), Query Frame = -2
BLAST of CU172802 vs. NCBI nr
Match: gi|1009126374|ref|XP_015880119.1| (PREDICTED: uncharacterized protein LOC107416175 [Ziziphus jujuba]) HSP 1 Score: 85.1 bits (209), Expect = 5.2e-14 Identity = 39/68 (57.35%), Postives = 48/68 (70.59%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|