CU172283 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGGAGCGAGGTTTGTGCCATGTTATGGATGTGGAGGGGAGCTGTAAAGTGATAAAAAGGGGACACAAAGGAGAGATGTGGAGCATGCAATGAGAATGGTTTGGCTCACTGCCCTGCCTGTCATTGAAACTATCTTTGATGCCATCATAGAATAATGGAATTTGAATTGCTATTTTTAACTCTTTGGTTTGTTGTT
BLAST of CU172283 vs. TrEMBL
Match: A0A0A0KQR0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G148770 PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 1.2e-06 Identity = 25/29 (86.21%), Postives = 26/29 (89.66%), Query Frame = 3
BLAST of CU172283 vs. TrEMBL
Match: A0A0A0KQR0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G148770 PE=4 SV=1) HSP 1 Score: 33.9 bits (76), Expect = 9.0e+01 Identity = 15/25 (60.00%), Postives = 16/25 (64.00%), Query Frame = 1
BLAST of CU172283 vs. NCBI nr
Match: gi|449452408|ref|XP_004143951.1| (PREDICTED: uncharacterized protein LOC101208965 [Cucumis sativus]) HSP 1 Score: 62.0 bits (149), Expect = 4.4e-07 Identity = 25/29 (86.21%), Postives = 26/29 (89.66%), Query Frame = 3
BLAST of CU172283 vs. NCBI nr
Match: gi|659074080|ref|XP_008437411.1| (PREDICTED: uncharacterized protein LOC103482835 [Cucumis melo]) HSP 1 Score: 61.2 bits (147), Expect = 7.6e-07 Identity = 25/29 (86.21%), Postives = 26/29 (89.66%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|