CU172274 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGTCCTTTGTGCTGTGGTCTCACACCCAGCTGACAATCTTGTCTCTTTTCTAAACAATGCAAAGGGTGCAACTGCCGGGGGTGCTGTCAGGCAGCTAGGTTTATGGGGTCTTTTCACTCGTGGCCTTCCACTTCGGATTGTTATGATTGGAACTCTTACCGGGTCTCAATGGGGAATATATGACGCAT
BLAST of CU172274 vs. Swiss-Prot
Match: MPCP3_ARATH (Mitochondrial phosphate carrier protein 3, mitochondrial OS=Arabidopsis thaliana GN=MPT3 PE=2 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 3.8e-24 Identity = 51/62 (82.26%), Postives = 56/62 (90.32%), Query Frame = 2
BLAST of CU172274 vs. Swiss-Prot
Match: MPCP2_ARATH (Mitochondrial phosphate carrier protein 2, mitochondrial OS=Arabidopsis thaliana GN=MPT2 PE=2 SV=1) HSP 1 Score: 106.3 bits (264), Expect = 1.2e-22 Identity = 47/62 (75.81%), Postives = 53/62 (85.48%), Query Frame = 2
BLAST of CU172274 vs. Swiss-Prot
Match: MPCP_CAEEL (Phosphate carrier protein, mitochondrial OS=Caenorhabditis elegans GN=F01G4.6 PE=2 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.4e-12 Identity = 36/62 (58.06%), Postives = 44/62 (70.97%), Query Frame = 2
BLAST of CU172274 vs. Swiss-Prot
Match: MPCP_MOUSE (Phosphate carrier protein, mitochondrial OS=Mus musculus GN=Slc25a3 PE=1 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.4e-12 Identity = 35/62 (56.45%), Postives = 45/62 (72.58%), Query Frame = 2
BLAST of CU172274 vs. Swiss-Prot
Match: MPCP_RAT (Phosphate carrier protein, mitochondrial OS=Rattus norvegicus GN=Slc25a3 PE=1 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.4e-12 Identity = 35/62 (56.45%), Postives = 45/62 (72.58%), Query Frame = 2
BLAST of CU172274 vs. TrEMBL
Match: E5GBM3_CUCME (Mitochondrial phosphate transporter OS=Cucumis melo subsp. melo PE=3 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 1.3e-26 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 2
BLAST of CU172274 vs. TrEMBL
Match: A0A0A0LR40_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G000680 PE=3 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 1.3e-26 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 2
BLAST of CU172274 vs. TrEMBL
Match: B9RA83_RICCO (Mitochondrial phosphate carrier protein, putative OS=Ricinus communis GN=RCOM_1504210 PE=3 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 3.1e-25 Identity = 56/62 (90.32%), Postives = 60/62 (96.77%), Query Frame = 2
BLAST of CU172274 vs. TrEMBL
Match: B9I3Y2_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0012s10690g PE=3 SV=2) HSP 1 Score: 120.9 bits (302), Expect = 5.3e-25 Identity = 55/62 (88.71%), Postives = 61/62 (98.39%), Query Frame = 2
BLAST of CU172274 vs. TrEMBL
Match: A0A022QWZ5_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a008937mg PE=3 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 5.3e-25 Identity = 57/62 (91.94%), Postives = 60/62 (96.77%), Query Frame = 2
BLAST of CU172274 vs. NCBI nr
Match: gi|449440949|ref|XP_004138246.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial-like isoform X2 [Cucumis sativus]) HSP 1 Score: 126.7 bits (317), Expect = 1.4e-26 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 2
BLAST of CU172274 vs. NCBI nr
Match: gi|659128818|ref|XP_008464385.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial-like [Cucumis melo]) HSP 1 Score: 126.7 bits (317), Expect = 1.4e-26 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 2
BLAST of CU172274 vs. NCBI nr
Match: gi|778655223|ref|XP_011649327.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial-like isoform X1 [Cucumis sativus]) HSP 1 Score: 126.7 bits (317), Expect = 1.4e-26 Identity = 61/62 (98.39%), Postives = 61/62 (98.39%), Query Frame = 2
BLAST of CU172274 vs. NCBI nr
Match: gi|255540087|ref|XP_002511108.1| (PREDICTED: mitochondrial phosphate carrier protein 3, mitochondrial [Ricinus communis]) HSP 1 Score: 122.1 bits (305), Expect = 3.4e-25 Identity = 56/62 (90.32%), Postives = 60/62 (96.77%), Query Frame = 2
BLAST of CU172274 vs. NCBI nr
Match: gi|566197822|ref|XP_002318765.2| (hypothetical protein POPTR_0012s10690g [Populus trichocarpa]) HSP 1 Score: 121.3 bits (303), Expect = 5.9e-25 Identity = 55/62 (88.71%), Postives = 61/62 (98.39%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|