CU172218 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTACATTATTGTTCCCTTTTATGCTTTGTATTATTTTCTTCACCCAATACCTGAATTTGCCCACATTTTAATTTTGTGAAGGGCTCCTCCATCAATTATAGGATATTTTCCATACTTGACTTTCATATACAATGGCCCTTCAAGAGGTCTTTTGATTCCATATTTGGTGAGATCTCCATAAATTAGTTTGCTGAGCATCACAATGAATGAATCCAACAAA
BLAST of CU172218 vs. Swiss-Prot
Match: YUC5_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA5 OS=Arabidopsis thaliana GN=YUC5 PE=2 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 2.0e-08 Identity = 26/51 (50.98%), Postives = 37/51 (72.55%), Query Frame = -2
BLAST of CU172218 vs. Swiss-Prot
Match: YUC10_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA10 OS=Arabidopsis thaliana GN=YUC10 PE=2 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.3e-07 Identity = 26/63 (41.27%), Postives = 39/63 (61.90%), Query Frame = -2
BLAST of CU172218 vs. Swiss-Prot
Match: YUC3_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA3 OS=Arabidopsis thaliana GN=YUC3 PE=2 SV=1) HSP 1 Score: 54.3 bits (129), Expect = 6.5e-07 Identity = 26/51 (50.98%), Postives = 34/51 (66.67%), Query Frame = -2
BLAST of CU172218 vs. Swiss-Prot
Match: YUC9_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA9 OS=Arabidopsis thaliana GN=YUC9 PE=2 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 8.5e-07 Identity = 25/51 (49.02%), Postives = 34/51 (66.67%), Query Frame = -2
BLAST of CU172218 vs. Swiss-Prot
Match: YUC8_ARATH (Probable indole-3-pyruvate monooxygenase YUCCA8 OS=Arabidopsis thaliana GN=YUC8 PE=2 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.4e-06 Identity = 22/52 (42.31%), Postives = 36/52 (69.23%), Query Frame = -2
BLAST of CU172218 vs. TrEMBL
Match: A0A0A0L6W1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G190380 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 8.0e-20 Identity = 49/50 (98.00%), Postives = 50/50 (100.00%), Query Frame = -2
BLAST of CU172218 vs. TrEMBL
Match: A0A0A0L6W1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G190380 PE=4 SV=1) HSP 1 Score: 29.6 bits (65), Expect = 1.9e+03 Identity = 12/13 (92.31%), Postives = 13/13 (100.00%), Query Frame = -3
HSP 2 Score: 83.2 bits (204), Expect = 1.5e-13 Identity = 36/51 (70.59%), Postives = 43/51 (84.31%), Query Frame = -2
BLAST of CU172218 vs. TrEMBL
Match: M5VJ66_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa007054mg PE=4 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 5.5e-13 Identity = 36/51 (70.59%), Postives = 43/51 (84.31%), Query Frame = -2
BLAST of CU172218 vs. TrEMBL
Match: I1JQG5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_03G208900 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.6e-12 Identity = 35/50 (70.00%), Postives = 41/50 (82.00%), Query Frame = -2
BLAST of CU172218 vs. TrEMBL
Match: A0A022S2S3_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a018417mg PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.6e-12 Identity = 33/50 (66.00%), Postives = 41/50 (82.00%), Query Frame = -2
BLAST of CU172218 vs. NCBI nr
Match: gi|778679924|ref|XP_011651215.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Cucumis sativus]) HSP 1 Score: 105.1 bits (261), Expect = 5.1e-20 Identity = 49/50 (98.00%), Postives = 50/50 (100.00%), Query Frame = -2
BLAST of CU172218 vs. NCBI nr
Match: gi|922346844|ref|XP_013450334.1| (flavin-binding monooxygenase-like protein [Medicago truncatula]) HSP 1 Score: 84.0 bits (206), Expect = 1.2e-13 Identity = 36/51 (70.59%), Postives = 43/51 (84.31%), Query Frame = -2
BLAST of CU172218 vs. NCBI nr
Match: gi|1009147838|ref|XP_015891623.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Ziziphus jujuba]) HSP 1 Score: 84.0 bits (206), Expect = 1.2e-13 Identity = 37/51 (72.55%), Postives = 43/51 (84.31%), Query Frame = -2
BLAST of CU172218 vs. NCBI nr
Match: gi|595792373|ref|XP_007199935.1| (hypothetical protein PRUPE_ppa007054mg [Prunus persica]) HSP 1 Score: 82.0 bits (201), Expect = 4.6e-13 Identity = 36/51 (70.59%), Postives = 43/51 (84.31%), Query Frame = -2
BLAST of CU172218 vs. NCBI nr
Match: gi|659123221|ref|XP_008461553.1| (PREDICTED: probable indole-3-pyruvate monooxygenase YUCCA10 [Cucumis melo]) HSP 1 Score: 81.6 bits (200), Expect = 6.1e-13 Identity = 38/50 (76.00%), Postives = 43/50 (86.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|