CU172047 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU172047
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	Transmembrane 9 superfamily member
Location	Chr1 : 12540428 .. 12540542 (+)
Sequence length	121

The following sequences are available for this feature:

GGCTGATGATCAGATTCACTGGTTTTCAATAGTTAATTCCTTGATGATTGTTTCCTTTTCCTCTCGGTATGGTGGCCATGATTATGTTGAGGACACTTTACCGTGATATTTCTAATATATC


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa1G256720	Csa1G256720	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0150880	H0150880	EST