CU171978 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATTGATTCCATTTTTTGATGTCAACACAAGATCATAAAGCTGGGTTCATGATTGTCCCACTAATTGAAACATCCCAAGTTGCATCTTCTTGGCTGACCTTATTACAATTTTGAATCACAGCTAAA
BLAST of CU171978 vs. TrEMBL
Match: A0A0A0KN71_CUCSA (rRNA N-glycosidase OS=Cucumis sativus GN=Csa_5G428440 PE=3 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 1.5e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -2
BLAST of CU171978 vs. NCBI nr
Match: gi|449445192|ref|XP_004140357.1| (PREDICTED: nigrin b [Cucumis sativus]) HSP 1 Score: 63.9 bits (154), Expect = 7.4e-08 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|