CU171647 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTCTTTCTGTCTCGTCATACAATCCAATGAGAGAACCTTTTCATAGAACATTTGGAAGTTCACTGTCATTGCAGTCACCTGCTGGAAGATCTTCAATAAAGATTGCTCCTTTTATGAGGGAGAGC
BLAST of CU171647 vs. TrEMBL
Match: A0A0A0L0L6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G099740 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 1.4e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU171647 vs. NCBI nr
Match: gi|778691846|ref|XP_011653362.1| (PREDICTED: uncharacterized protein LOC101218523 isoform X1 [Cucumis sativus]) HSP 1 Score: 72.0 bits (175), Expect = 2.7e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU171647 vs. NCBI nr
Match: gi|700198513|gb|KGN53671.1| (hypothetical protein Csa_4G099740 [Cucumis sativus]) HSP 1 Score: 72.0 bits (175), Expect = 2.7e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU171647 vs. NCBI nr
Match: gi|659111150|ref|XP_008455604.1| (PREDICTED: uncharacterized protein LOC103495739 isoform X1 [Cucumis melo]) HSP 1 Score: 72.0 bits (175), Expect = 2.7e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU171647 vs. NCBI nr
Match: gi|778691849|ref|XP_011653363.1| (PREDICTED: uncharacterized protein LOC101218523 isoform X2 [Cucumis sativus]) HSP 1 Score: 72.0 bits (175), Expect = 2.7e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU171647 vs. NCBI nr
Match: gi|659111152|ref|XP_008455605.1| (PREDICTED: uncharacterized protein LOC103495739 isoform X2 [Cucumis melo]) HSP 1 Score: 72.0 bits (175), Expect = 2.7e-10 Identity = 35/37 (94.59%), Postives = 36/37 (97.30%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|