CU171328 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCGACTCTTGTTTGCAGTATTCTATGCTCCAGTTTTGCAGCCTGCAACCATAAATTTTCACTGAATTTGGTATTGACTTTGCTCCCCTTGGCGATCACTGCCTTTGCCTCATCTGGGCTAGCCAGCCTACAAGCTTCCAACCACACATCTTCATTCTTGGGACACTCTTCACATCCTTTTTGAATCAATTGCCTCGCTGCTTGAATCCTTCCCTGCCTACTTCCT
BLAST of CU171328 vs. Swiss-Prot
Match: STA1_ARATH (Protein STABILIZED1 OS=Arabidopsis thaliana GN=STA1 PE=1 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 9.8e-19 Identity = 45/65 (69.23%), Postives = 52/65 (80.00%), Query Frame = -2
BLAST of CU171328 vs. Swiss-Prot
Match: PRP6_BOVIN (Pre-mRNA-processing factor 6 OS=Bos taurus GN=PRPF6 PE=2 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.4e-09 Identity = 32/62 (51.61%), Postives = 42/62 (67.74%), Query Frame = -2
BLAST of CU171328 vs. Swiss-Prot
Match: PRP6_HUMAN (Pre-mRNA-processing factor 6 OS=Homo sapiens GN=PRPF6 PE=1 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.4e-09 Identity = 32/62 (51.61%), Postives = 42/62 (67.74%), Query Frame = -2
BLAST of CU171328 vs. Swiss-Prot
Match: PRP6_MOUSE (Pre-mRNA-processing factor 6 OS=Mus musculus GN=Prpf6 PE=1 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.4e-09 Identity = 32/62 (51.61%), Postives = 42/62 (67.74%), Query Frame = -2
BLAST of CU171328 vs. Swiss-Prot
Match: PRP6_PONAB (Pre-mRNA-processing factor 6 OS=Pongo abelii GN=PRPF6 PE=2 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.4e-09 Identity = 32/62 (51.61%), Postives = 42/62 (67.74%), Query Frame = -2
BLAST of CU171328 vs. TrEMBL
Match: E5GCN8_CUCME (Pre-mRNA splicing factor (Fragment) OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.3e-21 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = -2
BLAST of CU171328 vs. TrEMBL
Match: A0A0A0KDS6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G104100 PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.3e-21 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = -2
BLAST of CU171328 vs. TrEMBL
Match: A0A0D2SKM0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G202800 PE=4 SV=1) HSP 1 Score: 105.9 bits (263), Expect = 2.1e-20 Identity = 53/63 (84.13%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU171328 vs. TrEMBL
Match: A0A0D2SKM0_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G202800 PE=4 SV=1) HSP 1 Score: 32.3 bits (72), Expect = 3.0e+02 Identity = 16/56 (28.57%), Postives = 27/56 (48.21%), Query Frame = -2
HSP 2 Score: 105.5 bits (262), Expect = 2.8e-20 Identity = 52/63 (82.54%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU171328 vs. TrEMBL
Match: A5BAD3_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_024588 PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 2.8e-20 Identity = 52/63 (82.54%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU171328 vs. NCBI nr
Match: gi|449445509|ref|XP_004140515.1| (PREDICTED: protein STABILIZED1 [Cucumis sativus]) HSP 1 Score: 108.2 bits (269), Expect = 6.1e-21 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = -2
BLAST of CU171328 vs. NCBI nr
Match: gi|307136430|gb|ADN34237.1| (pre-mRNA splicing factor [Cucumis melo subsp. melo]) HSP 1 Score: 108.2 bits (269), Expect = 6.1e-21 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = -2
BLAST of CU171328 vs. NCBI nr
Match: gi|659119667|ref|XP_008459779.1| (PREDICTED: pre-mRNA-processing factor 6 [Cucumis melo]) HSP 1 Score: 108.2 bits (269), Expect = 6.1e-21 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = -2
BLAST of CU171328 vs. NCBI nr
Match: gi|823159762|ref|XP_012479715.1| (PREDICTED: protein STABILIZED1 [Gossypium raimondii]) HSP 1 Score: 105.5 bits (262), Expect = 4.0e-20 Identity = 53/63 (84.13%), Postives = 55/63 (87.30%), Query Frame = -2
BLAST of CU171328 vs. NCBI nr
Match: gi|672178533|ref|XP_008809401.1| (PREDICTED: protein STABILIZED1 [Phoenix dactylifera]) HSP 1 Score: 105.5 bits (262), Expect = 4.0e-20 Identity = 53/63 (84.13%), Postives = 54/63 (85.71%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|