CU170435 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTACACATTAACATTATAATTTATGGATAAAATAGTCAACATAAAAAAACAAAATTTGTCCAAGGAATATACATTGACATAATGAGATTACAGAAACATACAGCTTCAGCATTCCCAAATCTCAATCCGATTAGTCTTAGCCAAAGGTTTTTTCACTGCTGTAACACATGTACAGAAAGCCATCACCATCCTTGTATGAATCGTACACCGTACTCATTAAGCTAG
BLAST of CU170435 vs. Swiss-Prot
Match: ATG8I_ARATH (Autophagy-related protein 8i OS=Arabidopsis thaliana GN=ATG8I PE=1 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.1e-06 Identity = 22/28 (78.57%), Postives = 24/28 (85.71%), Query Frame = -3
BLAST of CU170435 vs. Swiss-Prot
Match: ATG8E_ORYSJ (Putative autophagy-related protein 8E OS=Oryza sativa subsp. japonica GN=ATG8E PE=3 SV=2) HSP 1 Score: 51.2 bits (121), Expect = 5.6e-06 Identity = 23/28 (82.14%), Postives = 24/28 (85.71%), Query Frame = -3
BLAST of CU170435 vs. Swiss-Prot
Match: ATG8D_ORYSJ (Autophagy-related protein 8D OS=Oryza sativa subsp. japonica GN=ATG8D PE=3 SV=2) HSP 1 Score: 51.2 bits (121), Expect = 5.6e-06 Identity = 23/28 (82.14%), Postives = 24/28 (85.71%), Query Frame = -3
BLAST of CU170435 vs. TrEMBL
Match: A0A0A0K6G3_CUCSA (Autophagy-related protein OS=Cucumis sativus GN=Csa_7G419640 PE=3 SV=1) HSP 1 Score: 63.2 bits (152), Expect = 1.6e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -3
BLAST of CU170435 vs. TrEMBL
Match: A0A169WP15_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_005728 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.9e-06 Identity = 26/28 (92.86%), Postives = 26/28 (92.86%), Query Frame = -3
BLAST of CU170435 vs. NCBI nr
Match: gi|449436361|ref|XP_004135961.1| (PREDICTED: autophagy-related protein 8i [Cucumis sativus]) HSP 1 Score: 64.3 bits (155), Expect = 1.0e-07 Identity = 28/28 (100.00%), Postives = 28/28 (100.00%), Query Frame = -3
BLAST of CU170435 vs. NCBI nr
Match: gi|659122904|ref|XP_008461385.1| (PREDICTED: autophagy-related protein 8i-like [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 6.6e-07 Identity = 27/28 (96.43%), Postives = 27/28 (96.43%), Query Frame = -3
BLAST of CU170435 vs. NCBI nr
Match: gi|1021047111|gb|KZN04891.1| (hypothetical protein DCAR_005728 [Daucus carota subsp. sativus]) HSP 1 Score: 59.7 bits (143), Expect = 2.5e-06 Identity = 26/28 (92.86%), Postives = 26/28 (92.86%), Query Frame = -3
BLAST of CU170435 vs. NCBI nr
Match: gi|698529048|ref|XP_009761353.1| (PREDICTED: autophagy-related protein 8i [Nicotiana sylvestris]) HSP 1 Score: 58.2 bits (139), Expect = 7.3e-06 Identity = 25/28 (89.29%), Postives = 26/28 (92.86%), Query Frame = -3
BLAST of CU170435 vs. NCBI nr
Match: gi|694188323|gb|AIS71902.1| (autophagy 8h [Nicotiana tabacum]) HSP 1 Score: 58.2 bits (139), Expect = 7.3e-06 Identity = 25/28 (89.29%), Postives = 26/28 (92.86%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|