CU170254 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAAAATATTAGGAGGTTTTTTGGTAGCATGCTGAAGAGGCCGAGGAAGAGGAGGAGGATGATTCCATTGATAAAGAATTACAAAACGAATTTGGATGGAGATTGTTCTCGTCCACAAAAGCATGCAAAGAGTCCTGAACTGGCTCGGGAGTTTCTTTTGGATGCTGCAACTGTCATCTTTAAAG
BLAST of CU170254 vs. TrEMBL
Match: A0A0A0KZE9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G563700 PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 4.8e-10 Identity = 39/61 (63.93%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. TrEMBL
Match: D7LVZ5_ARALL (Putative uncharacterized protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_486257 PE=4 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.4e-09 Identity = 37/61 (60.66%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. TrEMBL
Match: V7BIE2_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_007G261300g PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 4.0e-09 Identity = 38/61 (62.30%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. TrEMBL
Match: I1L2K3_SOYBN (Uncharacterized protein OS=Glycine max PE=4 SV=2) HSP 1 Score: 67.4 bits (163), Expect = 6.9e-09 Identity = 37/61 (60.66%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. TrEMBL
Match: A0A0R0IDG5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_09G109000 PE=4 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 6.9e-09 Identity = 37/61 (60.66%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. NCBI nr
Match: gi|778695132|ref|XP_011653932.1| (PREDICTED: uncharacterized protein LOC101210448 [Cucumis sativus]) HSP 1 Score: 70.9 bits (172), Expect = 8.9e-10 Identity = 39/61 (63.93%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. NCBI nr
Match: gi|659083255|ref|XP_008442254.1| (PREDICTED: uncharacterized protein LOC103486163 [Cucumis melo]) HSP 1 Score: 70.9 bits (172), Expect = 8.9e-10 Identity = 39/61 (63.93%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. NCBI nr
Match: gi|297817144|ref|XP_002876455.1| (hypothetical protein ARALYDRAFT_486257 [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 68.6 bits (166), Expect = 4.4e-09 Identity = 37/61 (60.66%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. NCBI nr
Match: gi|593690208|ref|XP_007145705.1| (hypothetical protein PHAVU_007G261300g [Phaseolus vulgaris]) HSP 1 Score: 67.8 bits (164), Expect = 7.6e-09 Identity = 38/61 (62.30%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU170254 vs. NCBI nr
Match: gi|729302470|ref|XP_010524691.1| (PREDICTED: uncharacterized protein LOC104802668 isoform X2 [Tarenaya hassleriana]) HSP 1 Score: 67.4 bits (163), Expect = 9.9e-09 Identity = 37/61 (60.66%), Postives = 42/61 (68.85%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|