CU170085 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATGCGGGTTTGTTCTTTGTAGATTTTGGGCCATTTCTTCGGAAGTCGGAGGATGTTCGAGTGTAAGGCTGGAAGGTATCGATTTCCACTGTTTTGATTGGATCTCTTTTGATCTGTTGAAGCTCTTCCCCTGCTTTCCCATGCCTTCCTTGAATTCCATTGATCTAACCACTTGGGTCTTTCTTCCAGATCATCTCCACC
BLAST of CU170085 vs. TrEMBL
Match: A0A0A0L5M1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G116810 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 6.8e-10 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = -1
BLAST of CU170085 vs. TrEMBL
Match: A0A0A0L5M1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G116810 PE=4 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 1.9e-04 Identity = 24/35 (68.57%), Postives = 27/35 (77.14%), Query Frame = -2
BLAST of CU170085 vs. NCBI nr
Match: gi|778676613|ref|XP_004134281.2| (PREDICTED: protein IQ-DOMAIN 1 [Cucumis sativus]) HSP 1 Score: 68.2 bits (165), Expect = 6.4e-09 Identity = 30/31 (96.77%), Postives = 31/31 (100.00%), Query Frame = -1
BLAST of CU170085 vs. NCBI nr
Match: gi|659074749|ref|XP_008437775.1| (PREDICTED: protein IQ-DOMAIN 1 [Cucumis melo]) HSP 1 Score: 66.6 bits (161), Expect = 1.9e-08 Identity = 29/31 (93.55%), Postives = 31/31 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|