CU169975 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACAAGAATTAAATGGCCATCCCTTCCAGGGTCCACTAACATCTGCGTAGGGGCCTTCTTTCAACTTTGACGTCACCCAACAAAGCTCAGCGAAATGGGGGTATCGCAGAATTTGATGACCAAAAGTAGATATTACTGAAATCAAGTTTGATTTCACTTTCATGGTTCTACTGCCAGGTAGTGGTGCAATTCTGAGAGAAGAAACATCAGGGGATTTCATTTCTCCATTGTGCTCGCTGGCTAGTTTTCTTTATCCTCCC
BLAST of CU169975 vs. TrEMBL
Match: A0A0A0L9H9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G236020 PE=4 SV=1) HSP 1 Score: 170.2 bits (430), Expect = 1.1e-39 Identity = 79/82 (96.34%), Postives = 81/82 (98.78%), Query Frame = -2
BLAST of CU169975 vs. TrEMBL
Match: V4UL74_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10007229mg PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 6.3e-24 Identity = 54/79 (68.35%), Postives = 64/79 (81.01%), Query Frame = -2
BLAST of CU169975 vs. TrEMBL
Match: M5X306_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa000091mg PE=4 SV=1) HSP 1 Score: 115.9 bits (289), Expect = 2.4e-23 Identity = 52/79 (65.82%), Postives = 62/79 (78.48%), Query Frame = -2
BLAST of CU169975 vs. TrEMBL
Match: F6H211_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_19s0014g02080 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 4.1e-23 Identity = 51/80 (63.75%), Postives = 63/80 (78.75%), Query Frame = -2
BLAST of CU169975 vs. TrEMBL
Match: A0A072VAP1_MEDTR (P-loop nucleoside triphosphate hydrolase superfamily protein, putative OS=Medicago truncatula GN=MTR_2g078630 PE=4 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.4e-22 Identity = 52/78 (66.67%), Postives = 61/78 (78.21%), Query Frame = -2
BLAST of CU169975 vs. NCBI nr
Match: gi|659112413|ref|XP_008456208.1| (PREDICTED: uncharacterized protein LOC103496212 [Cucumis melo]) HSP 1 Score: 172.6 bits (436), Expect = 3.1e-40 Identity = 79/82 (96.34%), Postives = 81/82 (98.78%), Query Frame = -2
BLAST of CU169975 vs. NCBI nr
Match: gi|778688579|ref|XP_011652783.1| (PREDICTED: uncharacterized protein LOC101208571 [Cucumis sativus]) HSP 1 Score: 172.6 bits (436), Expect = 3.1e-40 Identity = 79/82 (96.34%), Postives = 81/82 (98.78%), Query Frame = -2
BLAST of CU169975 vs. NCBI nr
Match: gi|700202501|gb|KGN57634.1| (hypothetical protein Csa_3G236020 [Cucumis sativus]) HSP 1 Score: 172.6 bits (436), Expect = 3.1e-40 Identity = 79/82 (96.34%), Postives = 81/82 (98.78%), Query Frame = -2
BLAST of CU169975 vs. NCBI nr
Match: gi|567919528|ref|XP_006451770.1| (hypothetical protein CICLE_v10007229mg [Citrus clementina]) HSP 1 Score: 119.8 bits (299), Expect = 2.4e-24 Identity = 54/79 (68.35%), Postives = 64/79 (81.01%), Query Frame = -2
BLAST of CU169975 vs. NCBI nr
Match: gi|568820638|ref|XP_006464816.1| (PREDICTED: uncharacterized protein LOC102619535 isoform X1 [Citrus sinensis]) HSP 1 Score: 119.8 bits (299), Expect = 2.4e-24 Identity = 54/79 (68.35%), Postives = 64/79 (81.01%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|