CU169656 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAATTCAAACAAAAAAATGAAGCAAGAGAATGTTGAAAAAGAGGATGCGAAGTGGAAACTGCTGGTGAAAAAGGTGTTGTCTGCCAAAACAATCTCTTCAGTTTGTCTTCCCAAAAGGAAGAGAGCAGTAAGGGACGCCATGAGCGCCGATTGCATCAAAAGCTTCCGATTACATCCGATACCTT
BLAST of CU169656 vs. TrEMBL
Match: A0A0A0LPZ8_CUCSA (Protein binding protein OS=Cucumis sativus GN=Csa_1G032450 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.0e-20 Identity = 53/54 (98.15%), Postives = 54/54 (100.00%), Query Frame = 3
BLAST of CU169656 vs. NCBI nr
Match: gi|449439605|ref|XP_004137576.1| (PREDICTED: BTB/POZ and TAZ domain-containing protein 1-like [Cucumis sativus]) HSP 1 Score: 101.7 bits (252), Expect = 4.7e-19 Identity = 53/54 (98.15%), Postives = 54/54 (100.00%), Query Frame = 3
BLAST of CU169656 vs. NCBI nr
Match: gi|659066340|ref|XP_008439713.1| (PREDICTED: BTB/POZ and TAZ domain-containing protein 1-like [Cucumis melo]) HSP 1 Score: 101.3 bits (251), Expect = 6.2e-19 Identity = 52/54 (96.30%), Postives = 54/54 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|