CU169618 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGTTCAATTGTTGTTGGATCGATTGATGGGGAAAATAAGGCTGTACTCGAAGACGTCGATGAGACAGGCAAAGACAGCCTTTTCCGGGGCTCGGTTCGCCGATTACTCATGTGGAAGTTACTTATGATGGCAAGTGGATTTTGGGGACTACTGATAGTTATTTGATACTGATCTGTTACTTTTATTCACTGATAAAGATGGCAACACGAAGA
BLAST of CU169618 vs. Swiss-Prot
Match: CYPR4_CYNCA (Protein CYPRO4 OS=Cynara cardunculus GN=CYPRO4 PE=2 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 6.4e-12 Identity = 30/36 (83.33%), Postives = 32/36 (88.89%), Query Frame = 3
HSP 2 Score: 37.4 bits (85), Expect = 7.9e-02 Identity = 18/27 (66.67%), Postives = 19/27 (70.37%), Query Frame = 2
BLAST of CU169618 vs. TrEMBL
Match: A0A022QBT9_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a002618mg PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.2e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. TrEMBL
Match: A0A022QBT9_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a002618mg PE=4 SV=1) HSP 1 Score: 37.4 bits (85), Expect = 8.8e+00 Identity = 18/27 (66.67%), Postives = 22/27 (81.48%), Query Frame = 2
HSP 2 Score: 72.0 bits (175), Expect = 3.2e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. TrEMBL
Match: A0A0A0LAA1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G207380 PE=4 SV=1) HSP 1 Score: 40.8 bits (94), Expect = 7.9e-01 Identity = 19/27 (70.37%), Postives = 23/27 (85.19%), Query Frame = 2
HSP 2 Score: 72.0 bits (175), Expect = 3.2e-10 Identity = 30/36 (83.33%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. TrEMBL
Match: A0A103YCN5_CYNCS (Vacuolar import/degradation, Vid27-related protein OS=Cynara cardunculus var. scolymus GN=Ccrd_014999 PE=4 SV=1) HSP 1 Score: 37.7 bits (86), Expect = 6.7e+00 Identity = 18/20 (90.00%), Postives = 18/20 (90.00%), Query Frame = 2
HSP 2 Score: 72.0 bits (175), Expect = 3.2e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. TrEMBL
Match: A0A067EX52_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g047036mg PE=4 SV=1) HSP 1 Score: 41.6 bits (96), Expect = 4.6e-01 Identity = 20/27 (74.07%), Postives = 23/27 (85.19%), Query Frame = 2
HSP 2 Score: 71.6 bits (174), Expect = 4.2e-10 Identity = 30/36 (83.33%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. NCBI nr
Match: gi|976922036|gb|KVI06650.1| (Vacuolar import/degradation, Vid27-related protein [Cynara cardunculus var. scolymus]) HSP 1 Score: 71.6 bits (174), Expect = 6.0e-10 Identity = 30/36 (83.33%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. NCBI nr
Match: gi|449445874|ref|XP_004140697.1| (PREDICTED: protein CYPRO4 [Cucumis sativus]) HSP 1 Score: 71.6 bits (174), Expect = 6.0e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. NCBI nr
Match: gi|848904003|ref|XP_012851706.1| (PREDICTED: protein CYPRO4 [Erythranthe guttata]) HSP 1 Score: 71.6 bits (174), Expect = 6.0e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. NCBI nr
Match: gi|568867557|ref|XP_006487103.1| (PREDICTED: protein CYPRO4 [Citrus sinensis]) HSP 1 Score: 71.6 bits (174), Expect = 6.0e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
BLAST of CU169618 vs. NCBI nr
Match: gi|659112226|ref|XP_008456123.1| (PREDICTED: protein CYPRO4 [Cucumis melo]) HSP 1 Score: 71.6 bits (174), Expect = 6.0e-10 Identity = 31/36 (86.11%), Postives = 34/36 (94.44%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|